Filipa Lucas

From OpenWetWare
Jump to: navigation, search

Exercício

Considere a seguinte representação de uma molécula biológica.

TTGACACTACCGAGGTGTACTATTTTTACCCGAGTCGCTAATTTTTGCCGCAAGGTGCTAAGCCGCGAGG AAAGCGAGGCTGAACAGGCAGTCGCCCGTCCACAGGTGACGGTGATCCCGCGTGAGCAGCATGCTATTTC CCGCAAAGATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGG


Lembre-se que qualquer representações tem subjacente um conjunto de convenções.

  • Que moléculas se podem representar desta forma e que convenções estarão implícitas nos diferentes casos?

As moléculas que se podem representar dessa forma, fazem parte do grupo dos ácidos nucleicos, que constituíem uma das unidades estruturais fundamentais de todas as formas de vida. Os ácidos nucleicos resultam da repetição de unidades mais simples denominadas nucleótidos. Neste exemplo o que é visivel são as bases nitrogenadas dos nucleótidos: purinas (T/U e C) e pirimidinas (A e G). Assim, a molécula representa tripletos de nucleótidos, em que cada tripleto tem uma correspondência em AA, através do código genético. Este tipo de representação está no formato do GenBank que por convenção representa sequências mRNA usando o alfabeto DNA, i.é, o uracilo (U) é substituído pela timina (T).


  • Supondo que se trata de DNA, indique uma forma de apresentação alternativa que represente melhor a sua estrutura real.


  • Poderá esta sequência conter um gene? Justifique a sua resposta.
  • Indique o resultado da transcrição desta sequência.
  • É possível prever que proteína se encontra codificada numa sequência nucleotídica?

Como?

  • A sequência apresentada codifica alguma proteína?

Consulte aqui o código genético

  • Que diferenças encontra se em vez de aplicar o código genético standard aplicar a variante bacteriana?
  • Como poderia saber de que organismo provém esta sequência?