Eccles:IFN qPCR primers

From OpenWetWare
Jump to: navigation, search

Eccles Lab > DGG Oligos > qPCR > Interferon (IFN) resonsive genes (Sybr)


  • Forward Primer: TCCCTGTTCAACACCCTCTTCT (DGG ID 2647, 41 uM)
  • Reverse Primer: GTCACGTCGCCAACCATCTT (DGG ID 2648, 38 uM)
  • link
  • Intron-spanning (exon 1 to 2; 2-exon gene), 102 bp amplicon, 666bp genomic product.


  • IL6 sense, 5'-CCACACAGACAGCCACTCAC-3' (DGG ID 2648, 46.2 uM)
  • IL6 antisense, 5'-AGGTTGTTTTCTGCCAGTGC-3' (DGG ID 2649, 39.9 uM)
  • Intron-spanning (exon 2 to 3; 5-exon gene), 146 bp amplicon, 1205 genomic product.
  • Paper


  • Forward Primer: CAGCACCTGATGGCCTATCA (20 bp) (DGG ID 2644, 31 uM)
  • Reverse Primer: ACGTCTGGAGCATGAAGAACTG (22 bp) (DGG ID 2645, 37.5 uM)
  • rtprimerdb link
  • Intron-spanning (exon 12 to 13), 87bp amplicon, 5746bp genomic product.


  • paper
  • 69 bp amplicon, forward primer spans exon 1/2 splice site, reverse in exon 2, 1386bp genomic product.

Not in-house

  • IFNb
    • IFN-b forward, 5'-TGC TTC TCC ACG ACA GCT CTT-3'
    • IFN-b reverse, 5'-TGA CAC TGA CAA TTG CTG CTT CT-3
  • OAS2
    • OAS2 forward, 5'-TCA GAA GAG AAG CCA ACG TGA-3'
    • OAS2 reverse 5'-CGG AGA CAG CGA GGG TAA AT-3'
    • No induction of anti-viral responses in human cell lines HeLa and MCF-7 when transfecting with siRNA or siLNA. Dahlgren C, Wahlestedt C, Thonberg H.Biochem Biophys Res Commun. 2006 Mar 24;341(4):1211-7,PMID: 16476582