Design 6 Oligo Form

From OpenWetWare
Jump to: navigation, search
Sequence Sequence (5\' - 3\')
Plate Row Column Name 5\' Mod (Ensure sequences are in ALL CAPS) 3\' Mod Comments
box_v6_A A 01 c6.0.1.1 TTGATAATAGCATT
box_v6_A A 02 c6.0.1.2 TGTCACAATCAATAGAAAATTCGACAGAATCAAGTGTTTTCA
box_v6_A A 03 c6.0.1.3 TCGGCATTCTACTAATAGTAGGAGGTCATTTTTGCGTCAGGA
box_v6_A A 04 c6.0.1.4 TTAGAGAATAGCGTCCAATACACGCTGCGCGTAACCGCTACA
box_v6_A A 05 c6.0.1.5 GGGCGCGTACTATGGTTGCTTATAACATCACTTGCAGGACGT
box_v6_A A 06 c6.0.1.6 TGGGAAGTTTAATTTCAACTTTAAGGGAACCGAACTAAATTG
box_v6_A A 07 c6.0.1.7 TGTCGAAAGGGTAGCAACGGCTGTGAGTGAATAACCATAGCG
box_v6_A A 08 c6.0.1.8 ATAGCTTAGATTAAGACGCTGTTCTGACCTAAATTACTAAAG
box_v6_A A 09 c6.0.1.9 GAATTGCTTGTCGTCTTTCCACCACCCTCAGAACCTTTTGCT
box_v6_A A 10 c6.0.1.10 CAGTACCTACATGGCTTTTGAACATACATAAAGGTGCGCCAA
box_v6_A A 11 c6.0.1.11 AGACAAAAGGGCGACATTCAACGTCACCAATGAAATGCCATC
box_v6_A A 12 c6.0.1.12 TTTTCATTATATTTTCATTTGTAATGCTGTAGCTCTCGAGCT
box_v6_A B 01 c6.0.1.13 TCAAAGCTCCCCCTCAAATGCGCGAAAGGAGCGGGAACGTGC
box_v6_A B 02 c6.0.1.14 TTTCCTCGTTAGAATCAGAGCTCACGCAAATTAACCGGAACA
box_v6_A B 03 c6.0.1.15 ACATTATACGAGAAACACCAGCGGTGTACAGACCAAGCGCGA
box_v6_A B 04 c6.0.1.16 AACAAAGTTCATGAGGAAGTTTGAATTACCTTTTTTGAATTT
box_v6_A B 05 c6.0.1.17 ATCAAAATCATAGGTCTGAGAACGCGAGAAAACTTTCCAAAA
box_v6_A B 06 c6.0.1.18 AAAAGGCTTCCACAGACAGCCCCACCACCCTCATTAGAGGCT
box_v6_A B 07 c6.0.1.19 GAGACTCTTAACGGGGTCAGTTAAGACTCCTTATTGAAGGTA
box_v6_A B 08 c6.0.1.20 AATATTGACGGAAATTATTCACAAAATCACCAGTAACCGGAA
box_v6_A B 09 c6.0.1.21 CCGCCTCACCATTAGATACATCGGTGTCTGGAAGTATTAAGA
box_v6_A B 10 c6.0.1.22 GGAAGCCCATAAATCAAAAATCGGGGAAAGCCGGCAGGCCGA
box_v6_A B 11 c6.0.1.23 TTAAAGGGATTTTAGACAGGATTTTTATAATCAGTTTTAGGA
box_v6_A B 12 c6.0.1.24 ATACCACAACGTAACAAAGCTGAGTAATCTTGACAATACACT
box_v6_A C 01 c6.0.1.25 AAAACACCACTACGAAGGCACAACATCAAGAAAACCCTCCGG
box_v6_A C 02 c6.0.1.26 CTTAGGTTGGGTTA
box_v6_A C 03 c6.0.1.27 AATTGTTATCCGCTCACAATTTCGTAATCATGGTCGTAGATT
box_v6_A C 04 c6.0.1.28 TAGTTTGCCTCAGAGCCGCCAACCACCCTCAGAGCTGCCCGT
box_v6_A C 05 c6.0.1.29 ATAAACACCTATTATTCTGAATATTATTTATCCCATTCATCG
box_v6_A C 06 c6.0.1.30 TAGGAATCATTACCGCGCCCAACGGGTATTAAACCCAACGCC
box_v6_A C 07 c6.0.1.31 TGTAGCATCCAAAAGGAGCCTATACCGATAGTTGCAAAATAC
box_v6_A C 08 c6.0.1.32 GTAATGCTCATCTTTGACCCCAAGAAACCACCAGACAAATCA
box_v6_A C 09 c6.0.1.33 ACAGTTGAAAGGAATTGAGGAAGCCAGCAGCAAATTAAGGCT
box_v6_A C 10 c6.0.1.34 TGCCCTGTACAGGTAGAAAGACAACACTATCATAAAAAACGA
box_v6_A C 11 c6.0.1.35 GAATGACCGAAAGACTTCAAATCACCAGTGAGACGAGCCGGA
box_v6_A C 12 c6.0.1.36 AGCATAAAGTGTAAAGCCTGGGGCTAGTACCCGTAATAACCT
box_v6_A D 01 c6.0.1.37 GTTTAGCAATCAAAATCACCGGCCAGCATTGACAGACTGGTA
box_v6_A D 02 c6.0.1.38 ATAAGTTCTCAAGAGAAGGATTCTTTCCAGAGCCTAGATATA
box_v6_A D 03 c6.0.1.39 GAAGGCTTATCCGGTATTCTAAAACCAATCAATAAAACGATC
box_v6_A D 04 c6.0.1.40 TAAAGTTGAATAATAATTTTTGCATAACCGATATAGGACTAA
box_v6_A D 05 c6.0.1.41 AGACTTTTACAACGGAGATTTTTAATTTTAAAAGTATCTTTA
box_v6_A D 06 c6.0.1.42 GGAGCACTAACAACTAATAGAGGCGGTCAGTATTATGGGCTT
box_v6_A D 07 c6.0.1.43 GAGATGGAAAAATCTACGTTACAAAATAGCGAGAGAAATATT
box_v6_A D 08 c6.0.1.44 CATTGAAGAACCAGACCGGAAGAGAGGCGGTTTGCGAGCTAA
box_v6_A D 09 c6.0.1.45 CTCACATTAATTGCGTTGCGCCCTTTGATAGCGAGAAGGTGG
box_v6_A D 10 c6.0.1.46 CATCAATTTTCGGTCATAGCCTTGATATTCACAAATCCAGTA
box_v6_A D 11 c6.0.1.47 AGCGTCAAGGCGGATAAGTGCCAGCTACAATTTTATTTAGCG
box_v6_A D 12 c6.0.1.48 AACCTCCCGACTTGCGGGAGGAACAAGAAAAATAAAATTTTC
box_v6_A E 01 c6.0.1.49 TGTATGGTTCAGCGGAGTGAGAAGGCCGCTTTTGCACAGCAT
box_v6_A E 02 c6.0.1.50 CGGAACGATCCGCGACCTGCTAACAATTCGACAACAGATAAT
box_v6_A E 03 c6.0.1.51 ACATTTGAGGATTT
box_v6_A E 04 c6.0.1.52 GAAGGGCGATCGGTGCGGGCCCGCCATTCGCCATTGGAATTA
box_v6_A E 05 c6.0.1.53 TTACCAGTAACGTCAAAAATGAAAATAGCAGCCTTAAAATAA
box_v6_A E 06 c6.0.1.54 ATTTTCGAGCCAGTAATAAGAAGTAGGGCTTAATTTCGCAAG
box_v6_A E 07 c6.0.1.55 GCGAATTATAATCCTGATTGTTTGGATTATACTTCCATTTTG
box_v6_A E 08 c6.0.1.56 CCCTTCTGACCTGAAAGCGTACAATCGTCTGAAATAAAGAGT
box_v6_A E 09 c6.0.1.57 TCAAGTTAATCCTGTTTGATGGTGGTTCCGAAATCGGTGGTT
box_v6_A E 10 c6.0.1.58 TTTCTTTTATCGCGTTTTAATAACATGTTTTAAATATGCAAC
box_v6_A E 11 c6.0.1.59 TAAAGTATTCGCAAATGGTCATAAGGATCCCCGGGCCAGCTG
box_v6_A E 12 c6.0.1.60 GCGAAAGGGGGATGTGCTGCACAGCTTTCCGGCACAGCAAGG
box_v6_A F 01 c6.0.1.61 CGAAGCCCATAAAAACAGGGAAGCGCATTAGACGGAACGCTA
box_v6_A F 02 c6.0.1.62 ACGAGCGTAGGATTAGCGGGGGCCACCCTCAGAACCGCCACC
box_v6_A F 03 c6.0.1.63 CTCAGAGCTCATAGTTAGCGTTCGGCTGTCTTTCCGACAAAA
box_v6_A F 04 c6.0.1.64 GGTAAAGTAATTCTGTCCAGATGCGTTATACAAATTAGTTAA
box_v6_A F 05 c6.0.1.65 CGCCTGAGTTAGAACCTACCATATCAAAATTATTTTTGCCCG
box_v6_A F 06 c6.0.1.66 ATTTTTGAATGGCTATTAGTCCAACAGGAAAAACGTTCTTTG
box_v6_A F 07 c6.0.1.67 ATTAGTATGACGAGCACGTATCGCTAGGGCGCTGGAAAAACC
box_v6_A F 08 c6.0.1.68 GTCTATCTAAATCAAAAGAATAGCCCGAGATAGGGGGCCAAC
box_v6_A F 09 c6.0.1.69 GCGCGGGGCAAACTCCAACAGGGATGGCTTAGAGCTTAATTG
box_v6_A F 10 c6.0.1.70 CTGAATAGGGCGCGAGCTGAAGCAAGTCCGCTAGCGGTAACG
box_v6_A F 11 c6.0.1.71 CCAGGGTTTTCCCAGTCACGAGGGACGACGACAGTACCGTAA
box_v6_A F 12 c6.0.1.72 TAATAAGCACCCTGAACAAAGTCAGAGGGTAATTGTGCTATT
box_v6_A G 01 c6.0.1.73 TCAGCTAATGCAGAACGCGCCACCGGAATCATAATACCGACC
box_v6_A G 02 c6.0.1.74 CAGTAACAATAAAGAAATTGCGTAGATT
box_v6_A G 03 c6.0.1.75 CGAACGAATAGCTG
box_v6_A G 04 c6.0.1.76 CAAGCGGTCCACGCTGGTTTGGCCCTTCACCGCCTATTGCAT
box_v6_A G 05 c6.0.1.77 CAAAAAGTTCATTCCATATAACAGTTGA
box_v6_A G 06 c6.0.1.78 AGACTGGGTACCTT
box_v6_A G 07 c6.0.1.79 AAAGCGGGGCCCTG
box_v6_A G 08 c6.0.1.80 CCGTGCATCTGCCAGTTTGAGCGTTGTAAAACGACAGGTCGA
box_v6_A G 09 c6.0.1.81 TTGTTCCAGAACGTGGACTCCAACGTCAAAGGGCGCAAGTGT
box_v6_A G 10 c6.0.1.82 AGCGGTCTGCGGAATCGTCATGCTTTTGCAAAAGAAGTTTTG
box_v6_A G 11 c6.0.1.83 CCAGAGGTCATTATACCAGTCCTGAGTAGAAGAACTCCAGAA
box_v6_A G 12 c6.0.1.84 CAATATTACCGCCAGCCATTGTTTAATGCGCGAACTAAAACA
box_v6_A H 01 c6.0.1.85 AAACAGAAGTACCTTTTACATCGGGAGAAACAATACATAAAT
box_v6_A H 02 c6.0.1.86 CAATATATACAGAGGCTTTGATTCGGTCGCTGAGGCTTGCAG
box_v6_A H 03 c6.0.1.87 GGAGTTAAATAGAAAGGAACATAATGGTTTGAAATTACTAGA
box_v6_A H 04 c6.0.1.88 AAAAGCCTGTTTAGTATCATACGACGACAATAAACTTACGAG
box_v6_A H 05 c6.0.1.89 CATGTAGAGAACGCGAGGCGTTCCTGAATCTTACCGAGAATT
box_v6_A H 06 c6.0.1.90 AACTGAAAGCAAGAAACAATGAAATAGCAATAGCTCAAACGT
box_v6_A H 07 c6.0.1.91 TCAGGAAGATCGCACTCCAGCAGGCGATTAAGTTGGACCGTA
box_v6_A H 08 c6.0.1.92 TCCCTTAAGGGCGATGGCCCACTACGTGAACCATCAGGAAGG
box_v6_A H 09 c6.0.1.93 GAAGAAATTTAAACAGTTCAGCCCTCGTTTACCAGACGACGA
box_v6_A H 10 c6.0.1.94 TAAAAACATAAAACGAACTAACGTTGTAGCAATACCTCATGG
box_v6_A H 11 c6.0.1.95 AAATACCTACATTTTGACGCTAGAATACGTGGCACAGTGCCA
box_v6_A H 12 c6.0.1.96 TGGAAGGTTGCTTTGAATACCAAGTTACAAAATCGTTAACAA
box_v6_B A 01 c6.0.1.97 TTTCATTTCCATTAAACGGGTGCCGACAATGACAACAACCAT
box_v6_B A 02 c6.0.1.98 CGCCCACTCACGTTGAAAATCTTTCAAATATATTTTCTTACC
box_v6_B A 03 c6.0.1.99 AGTATAAAGCCAACGCTCAACGAATATAAAGTACCTTATCAT
box_v6_B A 04 c6.0.1.100 AGAATAACTTTTTAAGAAAAGTAAGCAGATAGCCGAGAACTG
box_v6_B A 05 c6.0.1.101 GGTGCCGGAAACCAGGCAAAGTCTTCGCTATTACGTACCGAG
box_v6_B A 06 c6.0.1.102 AGGCGAATTTTGGGGTCGAGGTGCCGTAAAGCACTGATTTAG
box_v6_B A 07 c6.0.1.103 AGCTTGACAGGTCTTTACCCTCAAAAGGAATTACGAGGCATA
box_v6_B A 08 c6.0.1.104 GTAAGAGTTCATCAGTTGAGAGAGGCCACCGAGTAGGATTAT
box_v6_B A 09 c6.0.1.105 TTACATTGGCAGATTCACCAGTTCTGGCCAACAGAATCACCT
box_v6_B A 10 c6.0.1.106 CATCAATATTCATTTCAATTACCTGAGC
box_v6_B A 11 c6.0.1.107 ATAACGCGACTATT
box_v6_B A 12 c6.0.1.108 AACTGGCGGGTAAT
box_v6_B B 01 c6.0.1.109 CCAAATCATTCAAC
box_v6_B B 02 c6.0.1.110 GAACGAATACCTTA
box_v6_B B 03 c6.0.1.111 CGAGGCGCAGACGGTCAATCATAATCATTGTGAATCCACCAG
box_v6_B B 04 c6.0.1.112 CAGAAGATGATAGCCCTAAAACATCGCC
box_v6_B B 05 c6.0.1.113 CAAAAGAAGAACCG
box_v6_B B 06 c6.0.1.114 CTTTACACCATGTT
box_v6_B B 07 c6.0.1.115 GCGAAAGGGGATCG
box_v6_B B 08 c6.0.1.116 TGAAACACAACCTA
box_v6_B B 09 c6.0.1.117 GTGAATTTCTTAAACAGCTTGTTAATTGTATCGGTTGATGCA
box_v6_B B 10 c6.0.1.118 AATCCAAGAGAATCGCCATATTTAACAA
box_v6_B B 11 c6.0.1.119 CAACAGTGATTTTG
box_v6_B B 12 c6.0.1.120 TAAATGCTTATCAG
box_v6_B C 01 c6.0.1.121 TTTCGTCCATGTAC
box_v6_B C 02 c6.0.1.122 TAGGTGTATATAAG
box_v6_B C 03 c6.0.1.123 TTCGGAAGTTAATG
box_v6_B C 04 c6.0.1.124 CGCAGTCCCACGGA
box_v6_B C 05 c6.0.1.125 TAACCCACAAGAATTGAGTTAGAAACGCAAAGACATCTGAAT
box_v6_B C 06 c6.0.1.126 TTACCGTCAAATAAATCCTCATTAAAGC
box_v6_B C 07 c6.0.1.127 CAGAGCCCCCTCAG
box_v6_B C 08 c6.0.1.128 GTAGCGCTTGCCTT
box_v6_B C 09 c6.0.1.129 CCATTTGCAGGCTG
box_v6_B C 10 c6.0.1.130 AATAATATCACCGT
box_v6_B C 11 c6.0.1.131 TTTTGTTAAGGAAA
box_v6_B C 12 c6.0.1.132 GATTAGTAGCGCTA
box_v6_B D 01 c6.0.1.133 TTTTATTATCCAAA
box_v6_B D 02 c6.0.1.134 AGTCCTGTTTTGAA
box_v6_B D 03 c6.0.1.135 ATTTAGGTCGAGAA
box_v6_B D 04 c6.0.1.136 AATAAACTGTTTAT
box_v6_B D 05 c6.0.1.137 TTCCCTTAAATAAG
box_v6_B D 06 c6.0.1.138 GTCAGATTCGTCGC
box_v6_B D 07 c6.0.1.139 AGATGATCATCATA
box_v6_B D 08 c6.0.1.140 AGGGACATCACACG
box_v6_B D 09 c6.0.1.141 GGTAATATCAAACT
box_v6_B D 10 c6.0.1.142 AGAAGTGACGGTAC
box_v6_B D 11 c6.0.1.143 AATGCGCCACCACA
box_v6_B D 12 c6.0.1.144 AGCCCCCAAATCGG
box_v6_B E 01 c6.0.1.145 CTATTAAAGTTTGG
box_v6_B E 02 c6.0.1.146 TGCCAGCCCAGTCG
box_v6_B E 03 c6.0.1.147 TGCCTGCGGCCAGT
box_v6_B E 04 c6.0.1.148 AGGAACCACCAGTACAAACTAAAGTACCGCACTCACAGAGGC
box_v6_B E 05 c6.0.1.149 TCATCAAGCTCATTCAGTGAAGAAAAATCTAAAGCGATAGAA
box_v6_B E 06 c6.0.1.150 AGATGAAAACGAGTAGTAAATACACCGCCTGCAACAGACAAT
box_v6_B E 07 c6.0.1.151 AGTACCGGACGTTAGTAAATGTATCCCATCCTAATAACATGT
box_v6_B E 08 c6.0.1.152 ATTGGCCCCCTTATTAGCGTTCCATCGATAGCAGCATCGGCC
box_v6_B E 09 c6.0.1.153 AGCCGCCGAACCAGAGCCACCGCACCATTACCATTCGCTTCT
box_v6_B E 10 c6.0.2.1 GAGCCAGTTAAAGGTGAATTAACGGAATACCCAAAAACAAAG
box_v6_B E 11 c6.0.2.2 ACAAAGAGACTACCTTTTTAAAAAATTAATTACATCGCAGAG
box_v6_B E 12 c6.0.2.3 CTGTCCAGGGAGCTAAACAGGGAACGTGGCGAGAAACCCAAA
box_v6_B F 01 c6.0.2.4 CCGGAAACCGATTGAGGGAGGACGCAGTATGTTAGATCTTAC
box_v6_B F 02 c6.0.2.5 TTTCATCAGAAGAGTCAATAGTAATGGAAACAGTAACGGATT
box_v6_B F 03 c6.0.2.6 TCAGTAGCATATGGTTTACCAGGCAACATATAAAAAGCCCAA
box_v6_B F 04 c6.0.2.7 GTGTGATAGAATCCTTGAAAACTTGCTTCTGTAAAGAATATA
box_v6_B F 05 c6.0.2.8 CTCTAGATCACTGCCCGCTTTTGCATTAATGAATCTTGAGTG
box_v6_B F 06 c6.0.2.9 GAGGTGATTAGAGCCGTCAATTCGTATTAAATCCTGCACGTA
box_v6_B F 07 c6.0.2.10 TACGCATGGTGCCTAATGAGTGTATTGGGCGCCAGGGCAAAA
box_v6_B F 08 c6.0.2.11 CGCTGAGAGGTTATCTAAAATTTGAGTAACATTATTGAATAA
box_v6_B F 09 c6.0.2.12 TCCAAGAATAGCAAGCAAATCAATTTGCCAGTTACTACAGAG
box_v6_B F 10 c6.0.2.13 CTCGAATCCACACAACATACGGGCAACAGCTGATTCCCCAGC
box_v6_B F 11 c6.0.2.14 TGCTGAAATCTGGTCAGTTGGAGGAGCGGAATTATGGCAATT
box_v6_B F 12 c6.0.2.15 AATCAATCCTCAAA
box_v6_B G 01 c6.0.3.1 ACAGCCAACATGAAAGTATTATTCAGGGATAGCAAGCCCAAT
box_v6_B G 02 c6.0.3.2 CGGAACACAGCGATTATACCAGGCGCATAGGCTGGCTGACCT
box_v6_B G 03 c6.0.3.3 AACGTTAGTATCATCGCCTGATGACCAACTTTGAAAGAGGAC
box_v6_B G 04 c6.0.3.4 TTGCACCCGTCGAGAGGGTTGATCACCGTACTCAGGAGGTTT
box_v6_B G 05 c6.0.3.5 AGAAAATTGATACAGGAGTGTGAGGTTGAGGCAGGTCAGACG
box_v6_B G 06 c6.0.3.6 GCATGATGCCTTGAGTAACAGCGCCACCAGAACCACCACCAG
box_v6_B G 07 c6.0.4.1 GAGCCAGTTAAAGGTGAATTAACGGAATACCCAAAA
box_v6_B G 08 c6.0.4.2 ACAAAGTAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_B G 09 c6.0.4.3 ACAAAGAGACTACCTTTTTAAAAAATTAATTACATC
box_v6_B G 10 c6.0.4.4 GCAGAGTAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_B G 11 c6.0.4.5 CTGTCCAGGGAGCTAAACAGGGAACGTGGCGAGAAACCCAAA
box_v6_B G 12 c6.0.4.6 TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_B H 01 c6.0.4.7 CCGGAAACCGATTGAGGGAGGACGCAGTATGTTAGATCTTACT
box_v6_B H 02 c6.0.4.8 AAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_B H 03 c6.0.4.9 TTTCATCAGAAGAGTCAATAGTAATGGAAACAGTAACGGATT
box_v6_B H 04 c6.0.4.10 TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_B H 05 c6.0.4.11 TCAGTAGCATATGGTTTACCAGGCAACATATAAAAAGCCCAAT
box_v6_B H 06 c6.0.4.12 AAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_B H 07 c6.0.4.13 GTGTGATAGAATCCTTGAAAACTTGCTTCTGTAAAGAATATATAA
box_v6_B H 08 c6.0.4.14 AGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_B H 09 c6.0.4.15 CTCTAGATCACTGCCCGCTTTTGCATTAATGAATCTTGAGTG
box_v6_B H 10 c6.0.4.16 TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_B H 11 c6.0.4.17 GAGGTGATTAGAGCCGTCAATTCGTATTAAATCCTGCACGTAT
box_v6_B H 12 c6.0.4.18 AAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C A 01 c6.0.4.19 TACGCATGGTGCCTAATGAGTGTATTGGGCGCCAGGGCAAAATA
box_v6_C A 02 c6.0.4.20 AAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C A 03 c6.0.4.21 CGCTGAGAGGTTATCTAAAATTTGAGTAACATTATTGAATAAT
box_v6_C A 04 c6.0.4.22 AAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C A 05 c6.0.4.23 TCCAAGAATAGCAAGCAAATCAATTTGCCAGTTACTACAGAG
box_v6_C A 06 c6.0.4.24 TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C A 07 c6.0.4.25 CTCGAATCCACACAACATACGGGCAACAGCTGATTCCCCAGCTAA
box_v6_C A 08 c6.0.4.26 AGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C A 09 c6.0.4.27 TGCTGAAATCTGGTCAGTTGGAGGAGCGGAATTATGGCAATTTAA
box_v6_C A 10 c6.0.4.28 AGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C A 11 c6.0.4.29 AATCAATCCTCAAATAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C A 12 c6.0.5.1 ACAGCCAACATGAAAGTATTATTCAGGGATAGCAATAAAGAAAC
box_v6_C B 01 c6.0.5.2 TCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C B 02 c6.0.5.3 CGGAACACAGCGATTATACCAGGCGCATAGGCTGGTAAAGAA
box_v6_C B 03 c6.0.5.4 ACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C B 04 c6.0.5.5 AACGTTAGTATCATCGCCTGATGACCAACTTTGAATAAAG
box_v6_C B 05 c6.0.5.6 AAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C B 06 c6.0.5.7 TTGCACCCGTCGAGAGGGTTGATCACCGTACTCAGTAAAGAAAC
box_v6_C B 07 c6.0.5.8 TCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C B 08 c6.0.5.9 AGAAAATTGATACAGGAGTGTGAGGTTGAGGCAGGTAAAGAAA
box_v6_C B 09 c6.0.5.10 CTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C B 10 c6.0.5.11 GCATGATGCCTTGAGTAACAGCGCCACCAGAACCATAAAGAAA
box_v6_C B 11 c6.0.5.12 CTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_C B 12 c6.0.5.13 GCCCAATAGGAACCACCAGTACAAACTAAAGTACCGCACTCACAGAGGC
box_v6_C B 01 c6.0.5.14 CTGACCTTCATCAAGCTCATTCAGTGAAGAAAAATCTAAAGCGATAGAA
box_v6_C B 02 c6.0.5.15 AGAGGACAGATGAAAACGAGTAGTAAATACACCGCCTGCAACAGACAAT
box_v6_C B 03 c6.0.5.16 GAGGTTTAGTACCGGACGTTAGTAAATGTATCCCATCCTAATAACATGT
box_v6_C B 04 c6.0.5.17 TCAGACGATTGGCCCCCTTATTAGCGTTCCATCGATAGCAGCATCGGCC
box_v6_C B 05 c6.0.5.18 CCACCAGAGCCGCCGAACCAGAGCCACCGCACCATTACCATTCGCTTCT
box_v6_C B 06 *****
box_v6_C B 07 *****
box_v6_C B 08 *****
box_v6_C B 09 *****
box_v6_C B 10 *****
box_v6_C B 11 *****
box_v6_C B 12 *****
box_v6_C C 01 *****
box_v6_C C 02 *****
box_v6_C C 03 *****
box_v6_C C 04 *****
box_v6_C C 05 *****
box_v6_C C 06 *****
box_v6_C C 07 *****
box_v6_C C 08 *****
box_v6_C C 09 *****
box_v6_C C 10 *****
box_v6_C C 11 *****
box_v6_C C 12 *****
box_v6_C D 01 *****
box_v6_C D 02 *****
box_v6_C D 03 *****
box_v6_C D 04 *****
box_v6_C D 05 *****
box_v6_C D 06 *****
box_v6_C D 07 *****
box_v6_C D 08 *****
box_v6_C D 09 *****
box_v6_C D 10 *****
box_v6_C D 11 *****
box_v6_C D 12 *****
box_v6_C E 01 *****
box_v6_C E 02 *****
box_v6_C E 03 *****
box_v6_C E 04 *****
box_v6_C E 05 *****
box_v6_C E 06 *****
box_v6_C E 07 *****
box_v6_C E 08 *****
box_v6_C E 09 *****
box_v6_C E 10 *****
box_v6_C E 11 *****
box_v6_C E 12 *****
box_v6_C F 01 *****
box_v6_C F 02 *****
box_v6_C F 03 *****
box_v6_C F 04 *****
box_v6_C F 05 *****
box_v6_C F 06 *****
box_v6_C F 07 *****
box_v6_C F 08 *****
box_v6_C F 09 *****
box_v6_C F 10 *****
box_v6_C F 11 *****
box_v6_C F 12 *****
box_v6_C G 01 *****
box_v6_C G 02 *****
box_v6_C G 03 *****
box_v6_C G 04 *****
box_v6_C G 05 *****
box_v6_C G 06 *****
box_v6_C G 07 *****
box_v6_C G 08 *****
box_v6_C G 09 *****
box_v6_C G 10 *****
box_v6_C G 11 *****
box_v6_C G 12 *****
box_v6_C H 01 *****
box_v6_C H 02 *****
box_v6_C H 03 *****
box_v6_C H 04 *****
box_v6_C H 05 *****
box_v6_C H 06 *****
box_v6_C H 07 *****
box_v6_C H 08 *****
box_v6_C H 09 *****
box_v6_C H 10 *****
box_v6_C H 11 *****
box_v6_C H 12 *****