Dahlquist:Lactase Persistence Genotyping by qPCR

From OpenWetWare
Jump to navigationJump to search

HeaderBlueBig.gif Home        Research        Protocols        Notebook        People        Publications        Courses        Contact       


This protocol is based off of Weinlander, K. M., Hall, D. J., & De Stasio, E. A. (2010). RFLP analysis and allelic discrimination with real‐time PCR using the human lactase persistence trait. Biochemistry and Molecular Biology Education, 38(3), 167-171. doi: 10.1002/bmb.20357 (full text)

Primers

Forward primer sequence:

5'-GAGTGTAGTTGTTAGACGGAGAC-3'

qPCR primer sequence for T genotype:

5'-AGGCCAGGGACTACATTATC-3'

qPCR primer sequence for C genotype:

5'-AGGCCAGGGGCTACATTATC-3'

Weinlander qPCR primers aligned-to-448bp-product.jpg

Reaction Mix

From Weinlander paper:

7 ng genomic DNA
1.4 µL of 3.5 µM forward primer
1.4 µL of 3.5 µM reverse primer C or T
0.5 µL 50X ROX
12.5 µL master mix
Water to 25 µL

Note: the final concentration of each primer is 0.2 μM and the master mix contains modified Thermus brockianus DNA polymerase, dNTPs, SYBR Green, MgCl2, and buffer solution.

Modified from Apex qPCR GREEN Master Mix Manual:

Component                     Vol./reaction*             Final concentration*
Apex qPCR 2X Master Mix       12.5 μL                     1X
Primer A (10 μM)               0.5 μL (0.125 – 1.25 μL)   0.2 μM (0.05 – 0.5 μM)**
Primer B (10 μM)               0.5 μL (0.125 – 1.25 μL)   0.2 μM (0.05 – 0.5 μM)**
PCR-grade H2O                  6.5 μL                     ---
Template DNA                   5   μL                     genomic DNA: 20 ng (1 – 100 ng) or plasmid DNA: 0.5 ng (0.1 – 1 ng)
TOTAL volume                  25   μL                     ---

* Suggested starting conditions; theoretically used conditions in brackets.
** Optimization of primer concentrations is highly recommended. Note that I had to change the final concentration to 0.2 μM from 0.1 μM because manual incorrect for the 0.5 μL volume. I changed the theoretical volumes of the primer to match the theoretical final concentrations.

Organizing Reactions

  • Each sample (template) needs to be run with two different primer pairs, which means two master mixes will be made, one for each primer pair:
    • Forward + Reverse (C)
    • Forward + Reverse (T)
  • Each sample + primer pair needs to be run in duplicate or triplicate as technical replicates to account for technical differences (pipetting error, etc.)
  • There needs to be a negative no DNA template control (using water instead of DNA) for each primer pair/master mix
  • We will use the plasmids as positive controls, "T" plasmid, "C" plasmid, and a mix of "T" and "C" plasmid. Each of these is run with both primer pairs.
    • We should do a dilution series of 3-5 dilutions for each of these to determine the right concentration of plasmid template to use going forward.

Instrument Protocol

qPCR carried out in four stages run consecutively.

  1. Stage 1: 50.0°C for 2 minutes.
  2. Stage 2: 95.0°C for 10 minutes.
  3. Stage 3: 40 cycles of 95.0°C (for 15 seconds) and 60.0°C (for 1 minute).

Results for each sample were determined by selecting only the amplification plots of both tubes after the threshold was set.

Troubleshooting

  • Sigma-Aldrich qPCR Guide
  • Their recommended standard instrument protocol is:
    1. Initial denaturation 94°C for 2 min
    2. Denaturation 94°C for 15 sec
    3. Annealing, extension, and read fluorescence 60°C or 5°C below lowest primer TM for 1 min
    4. repeat steps 2 and 3 for 40 cycles
  • has diagram regarding how SYBR works
  • explains quantification cycle relative to amount of starting material (i.e. dilutions)
  • lists supplies needed and components of assay and why each is important
  • has troubleshooting guide

PrimerXL Design

This DMAS (double-mismatch allele-specific) assay was designed at PrimerXL.org, based on the paper:

  • Lefever, S., Rihani, A., Van der Meulen, J., Pattyn, F., Van Maerken, T., Van Dorpe, J., ... & Vandesompele, J. (2019). Cost-effective and robust genotyping using double-mismatch allele-specific quantitative PCR. Scientific reports, 9(1), 2150. https://doi.org/10.1038/s41598-019-38581-z
Assay information	
Ensembl build                     Release 75, build 37
Taxonomy ID                       9606
Description                       rs4988235
Target                            rs4988235
Template                          gdna
Constant primer                   GCGAAGATGGGACGCTTGAA
Allele-specific primer 1          CGCTGGCAATACAGATAAGATAATGCAGC
Allele-specific primer 2          CGCTGGCAATACAGATAAGATAATGCAGT
Amplicon                          GCGAAGATGG GACGCTTGAA TGCCCTTTCG TACTACTCCC CTTTTACCTC
                                  GTTAATACCC ACTGACCTAT CCTCGTGGAA TGCAGGGCTC AAAGAACAAT 
                                  CTAAAAATCA AACATTATAC AAATGCAACC TAAGGAGGAG AGTTCCTTTG 
                                  AGGCCAGGGG CTACATTATC TTATCTGTAT TGCCAGCG
Length                            188
Amplicon location                 2:136608487-136608674
Design settings	
SNP analysis                       relaxed
Sec. struct. analysis              relaxed
Specificity analysis               yes
Primer annealing Tm (min-opt-max)  63.00-65.00-67.00
Primer GC% (min-opt-max)	   20.00-50.00-80.00
Amplicon length range	           80-250
# G/C's in last 5 3' primer bp	   5
Mg concentration	           0.05
Na concentration	           0.003
DNA concentration	           250
dNTP concentration	           1.2
PCR reaction temperature	   60
Double-stranded 188 bp amplicon (primers bolded)

5’-GCGAAGATGG GACGCTTGAA TGCCCTTTCG TACTACTCCC CTTTTACCTC GTTAATACCC ACTGACCTAT CCTCGTGGAA TGCAGGGCTC-3’
3’-CGCTTCTACC CTGCGAACTT ACGGGAAAGC ATGATGAGGG GAAAATGGAG CAATTATGGG TGACTGGATA GGAGCACCTT ACGTCCCGAG-5’

5’-AAAGAACAAT CTAAAAATCA AACATTATAC AAATGCAACC TAAGGAGGAG AGTTCCTTTG AGGCCAGGGG CTACATTATC TTATCTGTAT-3’
3’-TTTCTTGTTA GATTTTTAGT TTGTAATATG TTTACGTTGG ATTCCTCCTC TCAAGGAAAC TCCGGTCCCC GATGTAATAG AATAGACATA-5’

5’-TGCCAGCG-3’
3’-ACGGTCGC-5’
  • "Blue" nucleotide is the site of the SNP (C/T).
  • "Red" nucleotide indicates DMAS mismatch in the 4th position from the 3' end of the allele-specific primer.

Relationship to 448 bp fragment from RFLP assay

448 bp RFLP fragment (sequence in DMAS amplicon red)

GGATGCACTG CTGTGATGAG GTATCAGAGT CACTTTGATA TGATGAGAGC
AGAGATAAAC AGATTTGTTG CATGTTTTTA ATCTTTGGTA TGGGACATAC
TAGAATTCAC TGCAAATACA TTTTTATGTA ACTGTTGAAT GCTCATACGA
CCATGGAATT CTTCCCTTTA AAGAGCTTGG TAAGCATTTG AGTGTAGTTG
TTAGACGGAG ACGATCACGT CATAGTTTAT AGAGTGCATA AAGACGTAAG
TTACCATTTA ATACCTTTCA TTCAGGAAAA ATGTACTTAG ACCCTACAAT
GTACTAGTAG GCCTCTGCGC TGGCAATACA GATAAGATAA TGTAGCCCCT
GGCCTCAAAG GAACTCTCCT CCTTAGGTTG CATTTGTATA ATGTTTGATT
TTTAGATTGT TCTTTGAGCC CTGCATTCCA CGAGGATAGG TCAGTGGG

Reverse complement of 188 bp DMAS amplicon (sequence in RFLP fragment red)
CGCTGGCAAT ACAGATAAGA TAATGTAGCC CCTGGCCTCA AAGGAACTCT
CCTCCTTAGG TTGCATTTGT ATAATGTTTG ATTTTTAGAT TGTTCTTTGA
GCCCTGCATT CCACGAGGAT AGGTCAGTGG GTATTAACGA GGTAAAAGGG
GAGTAGTACG AAAGGGCATT CAAGCGTCCC ATCTTCGC
BLAST results
Score	        Expect	Identities	Gaps	        Strand
243 bits(131)	5e-69	131/131(100%)	0/131(0%)	Plus/Minus

Query  318  CGCTGGCAATACAGATAAGATAATGTAGCCCCTGGCCTCAAAGGAACTCTCCTCCTTAGG  377
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  188  CGCTGGCAATACAGATAAGATAATGTAGCCCCTGGCCTCAAAGGAACTCTCCTCCTTAGG  129

Query  378  TTGCATTTGTATAATGTTTGATTTTTAGATTGTTCTTTGAGCCCTGCATTCCACGAGGAT  437
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  128  TTGCATTTGTATAATGTTTGATTTTTAGATTGTTCTTTGAGCCCTGCATTCCACGAGGAT  69

Query  438  AGGTCAGTGGG  448
            |||||||||||
Sbjct  68   AGGTCAGTGGG  58