C5.0 Partial Oligo Order Form

From OpenWetWare
Jump to navigationJump to search
Plate Row Column Name 5\' Mod (Ensure sequences are in ALL CAPS) 3\' Mod Comments
box_v5_A A 01 c5.0.1.1 TAAAGTATAGCATT
box_v5_A A 02 c5.0.1.2 AAGTCAGAGGGTAATTGAGCGAAACCGAGGAAACGCTGGCAT
box_v5_A A 03 c5.0.1.3 GATTAAGTCTACTAATAGTAGCGGTGTCTGGAAGTATGCTGT
box_v5_A A 04 c5.0.1.4 AGCTCAAAAAGACTTCAAATAAGCAAAGCGGATTGGTAATAG
box_v5_A A 05 c5.0.1.5 TAAAATGAGGCAAGTCCGCTACGTATAAGGCGCTCACAATTC
box_v5_A A 06 c5.0.1.6 CACACAAGCCAGCTGCATTAAGGTAGAAAGATTCATACCAGT
box_v5_A A 07 c5.0.1.7 CAGGACGTTGGGAAGAAAAATACAAAGCTGCTCATATCCCTT
box_v5_A A 08 c5.0.1.8 ACTAAATGTGGCGAGAAAGGAAGGCCGATTAAAGGGAGGCCA
box_v5_A A 09 c5.0.1.9 CCGAGTATCCAGAACAATATTCTCAATCGTCTGAAACAGACA
box_v5_A A 10 c5.0.1.10 ATATTTTAAAAATACCGAACGAACCACCAGCAGAAAAGCATC
box_v5_A A 11 c5.0.1.11 ACCTTGCCTTGATACCGATAGTTTTTCACGTTGAAAATCTCC
box_v5_A A 12 c5.0.1.12 AAAAAAATCCAGACGTTAGTACCACCAGAAGGAGCCTGATTG
box_v5_A B 01 c5.0.1.13 TTTGGATTATACTTCTGAATACGTCAGATGAATATCCGCCAC
box_v5_A B 02 c5.0.1.14 CCTCAGACCAGGCGGATAAGTTGCCTATTTCGGAATACATGG
box_v5_A B 03 c5.0.1.15 CTTTTGATCAGACGATTGGCCCCCTCAGAACCGCCTCGGTCA
box_v5_A B 04 c5.0.1.16 TAGCCCCGGCTTATCCGGTATCCAGTTACAAAATAAACAGCC
box_v5_A B 05 c5.0.1.17 ATATTATGCAGCCTTTACAGAACCGTCACCGACTTTTTTGTC
box_v5_A B 06 c5.0.1.18 ACAATCAATAGAAAATTCATAAGTATGTTAGCAAACAGATAG
box_v5_A B 07 c5.0.1.19 CCGAACAGCAATAAAGCCTCAGAGCATAAAGCTAATATTTCA
box_v5_A B 08 c5.0.1.20 ACGCAAGTGATATTCAACCGTTAGCATGTCAATCATAAATCA
box_v5_A B 09 c5.0.1.21 GCTCATTCAGCTTTCATCAACTCTGCCAGTTTGAGACCGCTT
box_v5_A B 10 c5.0.1.22 CTGGTGCCAAGGCGATTAAGTTGGGTAACGCCAGGCGACGGC
box_v5_A B 11 c5.0.1.23 CAGTGCCATTCATTGAATCCCATAGTAAGAGCAACACTATCA
box_v5_A B 12 c5.0.1.24 TAACCCTGGAATACCACATTCCCCGCTTTCCAGTCAGCTGAT
box_v5_A C 01 c5.0.1.25 TGCCCTTCACCGCCTGGCCCTCTGGTTTGCCCCAGTAGTAAA
box_v5_A C 02 c5.0.1.26 TTGGGCTCAGATGAACGGTGTCAATCATAAGGGAAAAAAGAA
box_v5_A C 03 c5.0.1.27 TACACTATAATGCCACTACGACTGAGGCTTGCAGGACAACAA
box_v5_A C 04 c5.0.1.28 CCATCGCTGAGAGCCAGCAGCGACAACTCGTATTAAATCCTT
box_v5_A C 05 c5.0.1.29 TACTTTTGCGGGAGAAGCCTTATCGGTTGTACCAATACCGAA
box_v5_A C 06 c5.0.1.30 AATCCAACCCAATAGCAAGCAGCAAGCCGTTTTTACGCCTGT
box_v5_A C 07 c5.0.1.31 TTATCAACAATAGATAAGTCCAGTAATTCTGTCCACCTCAGA
box_v5_A C 08 c5.0.1.32 TTACCGTTACTAGAAAAAGCCATAGGTCTGTCCAATCGCAAG
box_v5_A C 09 c5.0.1.33 ACAAAGAGCGATAGCTTAGATGGTTTTGCTCAGTAACCGCCA
box_v5_A C 10 c5.0.1.34 CCCTCAGAACACTGAGTTTCGATGGGATTTTGCTATTGCGAA
box_v5_A C 11 c5.0.1.35 TAATAATTTGCGCCGACAATGGAGTTAAAGGCCGCTTGGCAG
box_v5_A C 12 c5.0.1.36 ATTCACCACTCAAACTATCGGCCTTGCTGGTAATAAAAGAGT
box_v5_A D 01 c5.0.1.37 CTGTCCAGACCCCCAGCGATTTACTTAGCCGGAACGAGGCGC
box_v5_A D 02 c5.0.1.38 AGACGGTACAGACCAGGCGCAAAGGAGCGGGCGCTAAATCAA
box_v5_A D 03 c5.0.1.39 GTTTTTTGGGGTCGAGGTGCCACTATTAAAGAACGGTTTGAT
box_v5_A D 04 c5.0.1.40 GGTGGTTGTGAGACGGGCAACGGGAAACCTGTCGTCATACGA
box_v5_A D 05 c5.0.1.41 CAGGCAAAGCGCCATTCGCCAGTGTAGATGGGCGCCTATTAT
box_v5_A D 06 c5.0.1.42 AGTCAGATCGCGTTTTAATTCGAGCTTCAAAGCGAATGGCTT
box_v5_A D 07 c5.0.1.43 AGAGCTTCATTAAATTTTTGTTATGTACCCCGGTTGATAATC
box_v5_A D 08 c5.0.1.44 AGAAAAGGCCGGAGACAGTCAAAGGTGGCATCAATACTCCTT
box_v5_A D 09 c5.0.1.45 ATTACGCTGGTTTACCAGCGCGGAAATTATTCATTATCGATA
box_v5_A D 10 c5.0.1.46 GCAGCACTTTCATCGGCATTTACCCTCAGAGCCACGAGAATA
box_v5_A D 11 c5.0.1.47 TAAAGTATTGAGAATCGCCATATTTAACAACGCCAATACCGA
box_v5_A D 12 c5.0.1.48 CCGTGTGACTGGTAATAAGTTAGTGCCCGTATAAACAGTTAA
box_v5_A E 01 c5.0.1.49 TGCCCCCGCCGTCGAGAGGGTATTTTCCCTTAGAAGGAAACA
box_v5_A E 02 c5.0.1.50 GTACATAAATCAATATATGTGTTTGAATACCAAGTTTTTACA
box_v5_A E 03 c5.0.1.51 TCGGGAGTCATCAATATAATCGGAATTATCATCATGTTGAAA
box_v5_A E 04 c5.0.1.52 GGAATAACAAACCCTCAATCAAAAACATCGCCATTTGAATGG
box_v5_A E 05 c5.0.1.53 CTATTAGTCTTTAA
box_v5_A E 06 c5.0.1.54 TATTTTTGATAATCGTAAAACTCTAGCTGATAAATATAACCT
box_v5_A E 07 c5.0.1.55 GTTTAGCACATAAAGGTGGCAACGGAATAAGTTTAGAGCCAT
box_v5_A E 08 c5.0.1.56 TTGGGAAACCATTACCATTAGCCATCTTTTCATAAACCGGAA
box_v5_A E 09 c5.0.1.57 ACGCTCAACCGGAATCATAATTCCAGTAAGCGTCACCTATTA
box_v5_A E 10 c5.0.1.58 TTCTGAAACATGAAAGTATTAATTAGGATTAGCGGTAAGACG
box_v5_A E 11 c5.0.1.59 CTGAGAATTAATTACATTTAACAATTTCATTTGAAATTTCAA
box_v5_A E 12 c5.0.1.60 TTACCTGATTTTCAGGTTTAAATGGAAGGGTTAGAAACATTA
box_v5_A F 01 c5.0.1.61 CAGAGGTCTGACCTGAAAGCGTAAGAATACGTGGCATGGATT
box_v5_A F 02 c5.0.1.62 AAATACGAAACACTCATCTTTTCACGCAAATTAACGTTAGAA
box_v5_A F 03 c5.0.1.63 TCAGAGCGGGAGCTAAACAGGAGGGAAGAAAGCGATAGGCTG
box_v5_A F 04 c5.0.1.64 GCTGACCTTGCCCTGACGAGAGAACTGGCTCATTATCAGTTG
box_v5_A F 05 c5.0.1.65 AGATTTACGTTTACCAGACGACGTCCAATACTGCGGGTCTTT
box_v5_A F 06 c5.0.1.66 ACCCTGAATCGTAACCGTGCAATTAAATGTGAGCGAGTAACA
box_v5_A F 07 c5.0.1.67 ACCCGTCTTTGTTAAAATTCGAATTGCTGAATATATTCATTC
box_v5_A F 08 c5.0.1.68 CATATAACAGTTGATTCCCAAGGGCGCGAGCTGAAAATCACC
box_v5_A F 09 c5.0.1.69 AAATTAAAAGTTACCAGAAGGCTAATATCAGAGAGAACAGGG
box_v5_A F 10 c5.0.1.70 AAGCGCACAGAGCCTAATTTGTCTAAGAACGCGAGAAGAACG
box_v5_A F 11 c5.0.1.71 GTAATAACACCCTCAGAGCCGGCCAGCATTGACAGGAGGTTG
box_v5_A F 12 c5.0.1.72 AGGCAGGTGATACAGGAGTGTATAAATAAGGCGTTTTTCAAA
box_v5_A G 01 c5.0.1.73 TATATTTTAGTTAATTTCATCGTCGCTATTAATTATGATATA
box_v5_A G 02 c5.0.1.74 AGTATAGAGGAGGTTTAGTACCATTCCACAGACAGAGTTTTG
box_v5_A G 03 c5.0.1.75 TCGTCTTAGGCTCCAAAAGGATTGCTTTCGAGGTGAAAGACA
box_v5_A G 04 c5.0.1.76 ATCATACAGGCAAGGCAAAGATTTAAATGCAATGCAAAGGGT
box_v5_A G 05 c5.0.1.77 CCGTGGGGATAGGTCACGTTGTTCAGGCTGCGCAACCTCTTC
box_v5_A G 06 c5.0.1.78 GCTATTACGCCAGCTGGCGAAGACCTTTGATAGCGTTTAGAC
box_v5_A G 07 c5.0.1.79 TATTACATGAATCGGCCAACGGGCGCCAGGGTGGTTTTTCTT
box_v5_A G 08 c5.0.1.80 TTCACCACCGAAATCGGCAAATCAGTGAATAAGGCTTCATCA
box_v5_A G 09 c5.0.1.81 AGAGTAAGACCTGCTCCATGTATACCAAGCGCGAAGACTTTT
box_v5_A G 10 c5.0.1.82 TCATGAGCACCCTCAGCAGCGAATTTCTTAAACAGTGAACCT
box_v5_A G 11 c5.0.1.82 CAAATATTACATTTGAGGATTTAGAAGTATTAGACGCGGAAC
box_v5_A G 12 c5.0.1.83 CCTGTAGCGCCACCCTCAGAAACAGTAACAGTACCTACAAAA
box_v5_A H 01 c5.0.1.84 TCGCGCAGAGGCGAATTATTCTTACCTTTTTTAATTCCTTGA
box_v5_A H 02 c5.0.1.85 AAACATAACGCGAGAAAACTTAAATAAGAATAAACACAGTAG
box_v5_A H 03 c5.0.1.86 GGCTTAACCGACAAAAGGTAATGAACAAGAAAAATAACCAAG
box_v5_A H 04 c5.0.1.87 TACCGCACTCATCGAGAACAAAATCAGATATAGAACTTATTA
box_v5_A H 05 c5.0.1.88 GCGTTTGCAAGGCCGGAAACGTCACCAATGAAACCAAAGGTG
box_v5_A H 06 c5.0.1.89 AATTATCGAGAATAACATAAAATAACCCACAAGAATTGAGTT
box_v5_A H 07 c5.0.1.90 AAGCCCATTAAGAAAAGTAAGCGTAGAAAATACATTATATTT
box_v5_A H 08 c5.0.1.91 CGGAAGCTAAATCAAAAATCAGAATCGTCATAAATAAGCTTG
box_v5_A H 09 c5.0.1.92 CATGCCTGCATAAAGTGTAAAGCCTGGGGTGCCTACGTTGCG
box_v5_A H 10 c5.0.1.93 CTCACTGAACTAATGCAGATACATTGTGAATTACCTTATGCG
box_v5_A H 11 c5.0.1.94 CAACGTCAAAGGGCGAAAAACGTGAACCATCACCCAGGGCGC
box_v5_A H 12 c5.0.1.95 TGGCAAGCCACACCCGCCGTCCGTTGTAGCAATACGCCTGAG
box_v5_B A 01 c5.0.1.96 TAGAAGAAGTCACACGACCAGGAGATAGAACCCTTGAGGCGG
box_v5_B A 02 c5.0.1.97 TCAGTATTAACACC
box_v5_B A 03 c5.0.1.98 ATGGTCATAATGCC
box_v5_B A 04 c5.0.1.99 CGCGTCTGGCCTTCCTGTAGCTTTTAACCAATAGGTCCTTTT
box_v5_B A 05 c5.0.1.100 GATAAGAAGATTTAGTTTGACCATTAGA
box_v5_B A 06 c5.0.1.101 AAGCCCGCATGTTT
box_v5_B A 07 c5.0.1.102 TAATTGCAACGCCA
box_v5_B A 08 c5.0.1.103 CACTCCAGCCAGCTTTCCGGCGGGACGACGACAGTAACGAGA
box_v5_B A 09 c5.0.1.104 ATGACCAAAACTCCAACAGGTCAGGATT
box_v5_B A 10 c5.0.1.105 AGAGGGGCATCAAA
box_v5_B A 11 c5.0.1.106 TTCAGAAATCGGCC
box_v5_B A 12 c5.0.1.107 ACGAGGCCCTCAAA
box_v5_B B 01 c5.0.1.108 TAACGGATTGCAAA
box_v5_B B 02 c5.0.1.109 CTTTAATCATAACG
box_v5_B B 03 c5.0.1.110 CAACGTACTACGTT
box_v5_B B 04 c5.0.1.111 AAGAGGATGAGATG
box_v5_B B 05 c5.0.1.112 TGACGGGGGATATT
box_v5_B B 06 c5.0.1.113 ATAAATTGTGTCGAAATCCGCTCTTGACAAGAACCGAAAGCC
box_v5_B B 07 c5.0.1.114 GGCGAACCGGAACCCTAAAGGGAGCCCC
box_v5_B B 08 c5.0.1.115 AAGAGGCCCGAACT
box_v5_B B 09 c5.0.1.116 AGAAGTGAGATTTG
box_v5_B B 10 c5.0.1.117 ACAGAGGCTTTGAGGACTAAAACAAAGTACAACGGTTTTTAT
box_v5_B B 11 c5.0.1.118 AATCAGTGATTTTAGACAGGAACGGTAC
box_v5_B B 12 c5.0.1.119 TCGGTCGAGGCACC
box_v5_B C 01 c5.0.1.120 GGAAATAAACGAGG
box_v5_B C 02 c5.0.1.121 TATCAGCGCCTTTA
box_v5_B C 03 c5.0.1.122 GCCACGCCCACGCA
box_v5_B C 04 c5.0.1.123 AGAAAGGAACAACTAAAGGAAAACAACTTTCAACATTAAAAG
box_v5_B C 05 c5.0.1.124 GATCTAACCCTCAT
box_v5_B C 06 c5.0.1.125 ATTAATTGTTTCAG
box_v5_B C 07 c5.0.1.126 CAATAGGAACCCATGTACCGTAGCCACCACCCTCAAAGAAAT
box_v5_B C 08 c5.0.1.127 TGCGTAGAGCAAAAGAAGATGATGAAAC
box_v5_B C 09 c5.0.1.128 CGTACTCCCCGGAA
box_v5_B C 10 c5.0.1.129 AGAAATATTTTCAG
box_v5_B C 11 c5.0.1.130 GAGAAGGAGAGGCT
box_v5_B C 12 c5.0.1.131 GAGTAACTTAACGG
box_v5_B D 01 c5.0.1.132 CGCAGTCTTAAAGC
box_v5_B D 02 c5.0.1.133 AGCCGCCCCACCAG
box_v5_B D 03 c5.0.1.134 AGCCACCTCAAAAT
box_v5_B D 04 c5.0.1.135 TAGCGTCCTCCCGA
box_v5_B D 05 c5.0.1.136 GCTGTCTTTCCTTATCATTCCGCGTTTTAGCGAACAGACTGT
box_v5_B D 06 c5.0.1.137 AGCGCGTCGTAATCAGTAGCGACAGAAT
box_v5_B D 07 c5.0.1.138 CAGTAGCTTAGAGC
box_v5_B D 08 c5.0.1.139 GGAGGGATAACTGA
box_v5_B D 09 c5.0.1.140 TTTGAAGCCTTAGCGTCTTTCTTAGACGGGAGAATAGGTAAA
box_v5_B D 10 c5.0.1.141 TATTGACCAAAGACAAAAGGGCGACATT
box_v5_B D 11 c5.0.1.142 AGACACCACATATA
box_v5_B D 12 c5.0.1.143 AAAAGAACAATAAT
box_v5_B E 01 c5.0.1.144 GCTATCTAAACATT
box_v5_B E 02 c5.0.1.145 TTAACGTAAACAAT
box_v5_B E 03 c5.0.1.146 TACCGCGATAAGAA
box_v5_B E 04 c5.0.1.147 CAGAACGTTTTCAT
box_v5_B E 05 c5.0.1.148 GCATTTTAGAAACC
box_v5_B E 06 c5.0.1.149 TATACAAACAACAT
box_v5_B E 07 c5.0.1.150 GTTTGAAACATGTA
box_v5_B E 08 c5.0.1.151 CAAAATCTGTTTAG
box_v5_B E 09 c5.0.1.152 GTAAATCTTCTGAC
box_v5_B E 10 c5.0.1.153 AACAAAAGAGTCAA
box_v5_B E 11 c5.0.1.154 TGATTGCAGTGAAT
box_v5_B E 12 c5.0.1.155 TGGCAATAAACAAT
box_v5_B F 01 c5.0.1.156 ATCAACAATTCCTG
box_v5_B F 02 c5.0.1.157 TAGCCCTATATCTG
box_v5_B F 03 c5.0.1.158 GCCAACATAATAAA
box_v5_B F 04 c5.0.1.159 ATCACTTTTCTTTG
box_v5_B F 05 c5.0.1.160 GTAACCATGTAGCG
box_v5_B F 06 c5.0.1.161 CCACTACCGTCTAT
box_v5_B F 07 c5.0.1.162 GGGTTGAAAAAGAA
box_v5_B F 08 c5.0.1.163 GTCCACGGAGAGAG
box_v5_B F 09 c5.0.1.164 CGTATTGCGCGGGG
box_v5_B F 10 c5.0.1.165 TTAATTGATGAGTG
box_v5_B F 11 c5.0.1.166 TAGTACCGCGACCG
box_v5_B F 12 c5.0.1.167 TGTAAAAGTTTTCC
box_v5_B G 01 c5.0.1.168 GTGCGGGCTGTTGG
box_v5_B G 02 c5.0.1.169 GTAATGGAACAAAC
box_v5_B G 03 c5.0.1.170 TTAAATTAGATTGT
box_v5_B G 04 c5.0.1.171 AGATTCACTGAGTA
box_v5_B G 05 *****
box_v5_B G 06 *****
box_v5_B G 07 *****
box_v5_B G 08 *****
box_v5_B G 09 *****
box_v5_B G 10 *****
box_v5_B G 11 *****
box_v5_B G 12 *****
box_v5_B H 01 *****
box_v5_B H 02 *****
box_v5_B H 03 *****
box_v5_B H 04 *****
box_v5_B H 05 *****
box_v5_B H 06 *****
box_v5_B H 07 *****
box_v5_B H 08 *****
box_v5_B H 09 *****
box_v5_B H 10 *****
box_v5_B H 11 *****
box_v5_B H 12 *****
box_v5_C A 01 c5.0.2.1 CCCTGCCAGGGATC
box_v5_C A 02 c5.0.2.2 GCCGCCACCAGAACCACCACCCGGAAGTTGGAAGCATCTGTA
box_v5_C A 03 c5.0.2.3 AGCAACTCCCTGGAGTGACTCCAGTGCCAAGCTTTCGCCAGG
box_v5_C A 04 c5.0.2.4 GTTTTCCTTCCGGCACCGCTTCGACAGTATCGGCCCTGTAGC
box_v5_C A 05 c5.0.2.5 CAGCTTTCAATAGGAACGCCAGTAAAACTAGCATGGAGAGTC
box_v5_C A 06 c5.0.2.6 TGGAGCAAGTAATGTGTAGGTAAATTTTTAGAACCCATTAAC
box_v5_C A 07 c5.0.2.7 ATCCAATCGAGCTGAAAAGGTGTTTTAAATATGCATTAGAGC
box_v5_C A 08 c5.0.2.8 TTAATTGCAAAAAGATTAAGAGGAAGCCCGAAAGACAAAAAT
box_v5_C A 09 c5.0.2.9 CAGGTCTCCAGAGGGGGTAATAGTAAAATGTTTAGAAGAGCA
box_v5_C A 10 c5.0.2.10 ACACTATTCTGGAAGTTTCATCTGTTTAGCTATATTTTCATT
box_v5_C A 11 c5.0.2.11 TGGGGCGAAATCATACAGGCACGATTTTAAGAACTATCAACG
box_v5_C A 12 c5.0.2.12 TAACAAAGCTGCTCATTCAGTGAACGGTGTACAGAGTGAGAA
box_v5_C B 01 c5.0.2.13 AGGCCGGATCTACAAAGGCTATCAGGTCATTGCCTTCAATCA
box_v5_C B 02 c5.0.2.14 TATGTACCTCATCTTTGACCCCTACAGAGGCTTTGAGGACTA
box_v5_C B 03 c5.0.2.15 AAGACTTGCTTGCAGGGAGTTGTGAGCGAGTAACACCGTGCA
box_v5_C B 04 c5.0.2.16 TCTGCCAGTTTGAGGGGACGACTGGTGCCGGAAACAATAATA
box_v5_C B 05 c5.0.2.17 ATTTTTTACGATCTAAAGTTTTGTCGTCTTTCCAGATGTACC
box_v5_C B 06 c5.0.2.18 GTAACACGGGTGGATGTTCTTAACCCCGCTTCTAATCTATTT
box_v5_C B 07 c5.0.2.19 ACGCTCGCGTCGGTGGGCACGTGCTCAGTACCAGGTTGAGTA
box_v5_C B 08 c5.0.2.20 ACAGTGCCCGTATAAACAGTTATTTACCGTTCCAGCATTGAC
box_v5_C B 09 c5.0.2.21 AGGAGGTTGAGGCAGGTCAGAAACAGGGCTTAAGCGAATCGG
box_v5_C B 10 c5.0.2.22 CTGACGCTGTCCCGCCAAAATCTAAGTGGTTGTGATGGCGAA
box_v5_C B 11 c5.0.2.23 AGGGGGATTCGCCATTCAGGCTGGGCGCATCGTAAACCCGTC
box_v5_C B 12 c5.0.2.24 GGATTCTAAATTCGCATTAAAAGAAAAGCCCCAAAGCTATTT
box_v5_C C 01 c5.0.2.25 TTGAGAGAGACAGTCAAATCAAATACTTTTGCGGGCAAAATT
box_v5_C C 02 c5.0.2.26 AAGCAATAAATGGTCAATAACTCCATATAACAGTTTTTAATT
box_v5_C C 03 c5.0.2.27 GCTCCTTTTTTAATTCGAGCTTCAAAGCGAACCAGCAAATGC
box_v5_C C 04 c5.0.2.28 TTTAAACAATACTGCGGAATCGTCATAA
box_v5_C C 05 c5.0.2.29 TCCTGGTTGGTGTAATGAGTACGATTGGCCTTGATAAGCCAG
box_v5_C C 06 c5.0.2.30 AATGGAAAGCGCAGTCTCTGAAATGCCCCCTGCCTAAGAGAA
box_v5_C C 07 c5.0.2.31 GGATTAGCCCTCAGAACCGCCCCCAATAGGAACCCACGTTAG
box_v5_C C 08 c5.0.2.32 TAAATGAATAGAAAGGAACAACTTAAACAGCTTGAATTCGGT
box_v5_C C 09 c5.0.2.33 CGCTGAGTTTCATGAGGAAGTGAAAGAGGCAAAAGGCTCCAT
box_v5_C C 10 c5.0.2.34 GTTACTTGAAAGAGGACAGATGAATAAGGCTTGCCAACTTTA
box_v5_C C 11 c5.0.2.35 ATCATTGAAAGATTCATCAGTTTACGAGGCATAGTACTGGAT
box_v5_C C 12 c5.0.2.36 AGCGTCCAGTTCAGAAAACGAGAATGACCATAAATCTTCAAA
box_v5_C D 01 c5.0.2.37 TATCGCGTTGATAAGAGGTCATTTTTGCGGATGGCACTAAAG
box_v5_C D 02 c5.0.2.38 TACGGTGCATAACCCTCGTTTACTAACGGAACAACATTATTA
box_v5_C D 03 c5.0.2.39 CAGGTAGTGAATTACCTTATGAGGCAAAGAATTAGAGAAGCC
box_v5_C D 04 c5.0.2.40 TTTATTTCAACGCAAGGATAAAAAGATTCAAAAGGCCAGGCG
box_v5_C D 05 c5.0.2.41 CATAGGCTGATAAATTGTGTCGAAATCCGCGACCTAATACAC
box_v5_C D 06 c5.0.2.42 TAAAACACCCGGTTGATAATCTTTTTGTTAAATCAGCTCATT
box_v5_C D 07 c5.0.2.43 TTTTAACCATCAACATTAAATAAAGGCCGCTTTTGTTTATCA
box_v5_C D 08 c5.0.2.44 GCTTGCTTTCGAGGTGAATTTCTAAAGGAATTGCGCAGGCAA
box_v5_C D 09 c5.0.2.45 AGCGCCATGTGCTGCAAGGCGATTAAGTTGGGTAACTCAGGA
box_v5_C D 10 c5.0.2.46 GAAGCCATGAGTTTCGTCACCACCGTACTCAGGAGGTTTAGT
box_v5_C D 11 c5.0.2.47 ACCGCCAGATTAGCGGGGTTTAATATAGGGGCCTTTACGTGG
box_v5_C D 12 c5.0.2.48 TGCTTGTTACCTCGATAAAGAAGAGCCGCCGCCAGTAAGCGT
box_v5_C E 01 c5.0.2.49 CATACATGGCTTTTGATGATAACGGGGTCAGTGCCCGGATAA
box_v5_C E 02 c5.0.2.50 GTGCCGTGGAATAGGTGTATCAGTACAAACTACAATCATAGT
box_v5_C E 03 c5.0.2.51 TAGCGTACACGTTGAAAATCTTTTAATTGTATCGGCGGGATC
box_v5_C E 04 c5.0.2.52 GTCACCCGAGGGTAGCAACGGCCAGCGATTATACCTTTGTAT
box_v5_C E 05 c5.0.2.53 CATCGCCTGGCTGACCTTCATTATTCATTACCCAAGGCTCAT
box_v5_C E 06 c5.0.2.54 TATACCACGTTAATAAAACGAACCAGACGACGATACAAAAGA
box_v5_C E 07 c5.0.2.55 AGTTTTGTTACCCTGACTATTATAGTCA
box_v5_C E 08 c5.0.2.56 GAATTGTCAACCTTATGACAAATTTCACATAAATCGGCTGAG
box_v5_C E 09 c5.0.2.57 ACTCCTCATTTCGGAACCTATTATTCTG
box_v5_C E 10 c5.0.2.58 ATTAAGAATTTCTC
box_v5_C E 11 c5.0.2.59 CGACGGCTATGATA
box_v5_C E 12 c5.0.2.60 CCTCTTCGCTATTACGCCAGCATTCATGCGCACGATCAGGGA
box_v5_C F 01 c5.0.2.61 TAGCAAGACCCTCAGAACCGCCACCCTC
box_v5_C F 02 c5.0.2.62 CTCATTTCTTAAGT
box_v5_C F 03 c5.0.2.63 GCCAGCTCAGTCAC
box_v5_C F 04 c5.0.2.64 GATAGGTCACGTTGGTGTAGATGCGCAACTGTTGGTCAGCGG
box_v5_C F 05 c5.0.2.65 AGTGAGAATTTTCTGTATGGGATTTTGC
box_v5_C F 06 c5.0.2.66 AACAGTTGAAGGGC
box_v5_C F 07 c5.0.2.67 GGCCTTCTCAGGAA
box_v5_C F 08 c5.0.2.68 GTAAACGTTAATATTTTGTTACCGTGGGAACAAACCGCATAA
box_v5_C F 09 c5.0.2.69 CCGATATTACCGATAGTTGCGCCGACAA
box_v5_C F 10 c5.0.2.70 TCGCCCAGGCGGAT
box_v5_C F 11 c5.0.2.71 GGTAATCTCAAAAA
box_v5_C F 12 c5.0.2.72 AAATTAATGCCGGAGAGGGTAAACAGGAAGATTGTCACCAAC
box_v5_C G 01 c5.0.2.73 CTAAAACTTCCATTAAACGGGTAAAATA
box_v5_C G 02 c5.0.2.74 ACGAAGGATAAGCA
box_v5_C G 03 c5.0.2.75 ATGCCTGAACAAGA
box_v5_C G 04 c5.0.2.76 CCAAAAACATTATGACCCTGTCCATCAATATGATAAACTGAC
box_v5_C G 05 c5.0.2.77 CAACTTTAGCCGGAACGAGGCGCAGACG
box_v5_C G 06 c5.0.2.78 GGAACCGTTCAACC
box_v5_C G 07 c5.0.2.79 GTAGTAGCTCATAT
box_v5_C G 08 c5.0.2.80 TGACCATTAGATACATTTCGCAAAGCCTCAGAGCAGATGGTT
box_v5_C G 09 c5.0.2.81 TAATTTCCTGACGAGAAACACCAGAACG
box_v5_C G 10 c5.0.2.82 GGCTTGATAAAGCT
box_v5_C G 11 c5.0.2.83 TCAACATGGCATCA
box_v5_C G 12 c5.0.2.84 AGGTCAGGATTAGAGAGTACCGATTCCCAATTCTGAACGCCA
box_v5_C H 01 c5.0.2.85 AAAGGAATGAGATTTAGGAATACCACAT
box_v5_C H 02 c5.0.2.86 GATACATCGAACGA
box_v5_C H 03 c5.0.2.87 ATTGCATCTGAATA
box_v5_C H 04 c5.0.2.88 TCCCCCTACCGGAA
box_v5_C H 05 c5.0.2.89 GCTTTTGAAAACCA
box_v5_C H 06 c5.0.2.90 AAATCTAGTCAGGA
box_v5_C H 07 c5.0.2.91 AACCGGACAAGAGT
box_v5_C H 08 c5.0.2.92 ACGGAGAAAGCGCG
box_v5_C H 09 c5.0.2.93 TCGGAACTCAGCAG
box_v5_C H 10 c5.0.2.94 AGGAGCCCCAAAAA
box_v5_C H 11 c5.0.2.95 ACAGCCCCGCCTGT
box_v5_C H 12 c5.0.2.96 ATAGCCCCGAGAGG
box_v5_D A 01 c5.0.2.97 AGTTTTACAGGAGT
box_v5_D A 02 c5.0.2.98 CTCATTAATTCACA
box_v5_D A 03 c5.0.3.1 CATTAAAGTAGCGC
box_v5_D A 04 c5.0.3.2 CGTTGCGCTCACTGCCCGCTTTTTAGCGTCAGACTGGTGAAT
box_v5_D A 05 c5.0.3.3 TATCACCAGGGAGGGAAGGTAATGTTAGCAAACGTCCAAAAG
box_v5_D A 06 c5.0.3.4 AACTGGCACCCACAAGAATTGCAAAGTCAGAGGGTGTTACAA
box_v5_D A 07 c5.0.3.5 AATAAACACCAACGCTAACGACCAATAGCAAGCAACAAGCCG
box_v5_D A 08 c5.0.3.6 TTTTTATGCCTGTTTATCAACACGACGACAATAAATTCTTAC
box_v5_D A 09 c5.0.3.7 CAGTATAACTAGAAAAAGCCTGATGCAAATCCAATCTCCGGC
box_v5_D A 10 c5.0.3.8 TTAGGTTGTGAGTGAATAACCTTGCTTCTGTAAATACAATTT
box_v5_D A 11 c5.0.3.9 CATTTGAGATTCGCCTGATTGCTTTGAATACCAAGAAAGAAA
box_v5_D A 12 c5.0.3.10 TTGCGTACGCGAGAAAACTTTAATAAGAATAAACACCGGAAT
box_v5_D B 01 c5.0.3.11 CATAATTAAGCCAACGCTCAATAACATTATCATTTACTAATA
box_v5_D B 02 c5.0.3.12 GATTAGAGCCGTCAATAGATAAATCAATATCTGGTGAACAAG
box_v5_D B 03 c5.0.3.13 AAAAATAACCAAGTACCGCACTCATCGAGAACAAGATCAGAT
box_v5_D B 04 c5.0.3.14 ATAGAAGCGCGAACTGATAGCTCACCAGTCACACGACCAGTA
box_v5_D B 05 c5.0.3.15 ATAAAAGCATTGCAACAGGAATCCCAATCCAAATAGACGGGA
box_v5_D B 06 c5.0.3.16 GAATTAACTGAACACCCTGAAAGTTAAGCCCAATACAGAATC
box_v5_D B 07 c5.0.3.17 CTGAGAACGCCGCTACAGGGCGCGTACTATGGTTGAAAGCGA
box_v5_D B 08 c5.0.3.18 AAGGAGCTAAAGGTGGCAACAAGACAAAAGGGCGACATTCAA
box_v5_D B 09 c5.0.3.19 CCGATTGGTCACCGACTTGAGCAACGTCAAAGGGCAAATCCT
box_v5_D B 10 c5.0.3.20 GTTTGATGGTGGTTCCGAAATGGGCAACAGCTGATCTGTCGT
box_v5_D B 11 c5.0.3.21 GCCAGCTGCATTAATGAATCGGATAGCAGCACCGTGAGCCAG
box_v5_D B 12 c5.0.3.22 CAAAATCTTTACCAGCGCCAATATAAAAGAAACGCTTACCAG
box_v5_D C 01 c5.0.3.23 AAGGAAACAATGAAATAGCAAAGGGAAGCGCATTAAGAAACG
box_v5_D C 02 c5.0.3.24 ATTTTTTAGTTGCTATTTTGCCTAAGAACGCGAGGAGAACGG
box_v5_D C 03 c5.0.3.25 GTATTAAATATCCCATCCTAAAGAATATAAAGTACTGAGAAT
box_v5_D C 04 c5.0.3.26 CGCCATATAAATAAGGCGTTATTCAAATATATTTTGAATTTA
box_v5_D C 05 c5.0.3.27 TCAAAATAATTTTCCCTTAGAATCCTTGAAAACATATGATGA
box_v5_D C 06 c5.0.3.28 AACAAACAGAGGCGAATTATTCATTTCA
box_v5_D C 07 c5.0.3.29 AACGTCACCAATGAAACCATCGCCAACGCGCGGGGGGGTGGT
box_v5_D C 08 c5.0.3.30 TTTTCTTTTCACCAGTGAGACCGGCAAAATCCCTTAGAGTCC
box_v5_D C 09 c5.0.3.31 ACTATTAACTAAATCGGAACCGAAAGGAAGGGAAGCTTTGAC
box_v5_D C 10 c5.0.3.32 GAGCACGAAAGGGATTTTAGATAGTAATAACATCAATATTAC
box_v5_D C 11 c5.0.3.33 CGCCAGCGGACATTCTGGCCAATTTTTGAATGGCTCTGCAAC
box_v5_D C 12 c5.0.3.34 AGTGCCAAATATCAAACCCTCATACATTTGAGGATCGAACGT
box_v5_D D 01 c5.0.3.35 TATTAATCCTGATTGTTTGGACGTAAAACAGAAATTTACAAA
box_v5_D D 02 c5.0.3.36 ATCGCGCATCAAGAAAACAAAATTAATTACATTTACGTCGCT
box_v5_D D 03 c5.0.3.37 ATTAATTCATAGGTCTGAGAGACTACCTTTTTAACCGCAAGA
box_v5_D D 04 c5.0.3.38 CAAAGAAGATTTTCAGGTTTATCAGATGATGGCAATTCATCA
box_v5_D D 05 c5.0.3.39 ATATAATTTTAAAAGTTTGAGCAGTAGGGCTTAATCGACAAA
box_v5_D D 06 c5.0.3.40 AGGTAAAGTAATTCTGTCCAGAATAGATAAGTCCTCAGTTGG
box_v5_D D 07 c5.0.3.41 CAAATCAGAGGTGAGGCGGTCAGTATTAACACCGCATTAGTC
box_v5_D D 08 c5.0.3.42 TTTAATGGCTTATCCGGTATTACCCAGCTACAATTTTATCCT
box_v5_D D 09 c5.0.3.43 GAATCTTAGCCATATTATTTAAAACGCTCATGGAATTAACCG
box_v5_D D 10 c5.0.3.44 TTGTAGCAATACTTCTTTGATCAGGAACGGTACGCATAAGAG
box_v5_D D 11 c5.0.3.45 CAAGAAACCGAGGAAACGCAATAATAACGGAATACAGAAAAT
box_v5_D D 12 c5.0.3.46 ACATACAGGGCGCTAGGGCGCGTTTTTTGGGGTCGAGGTGCC
box_v5_D E 01 c5.0.3.47 GTAAAGCAAGAACGTGGACTCCCATTTGGGAATTAAATCAGT
box_v5_D E 02 c5.0.3.48 AGCGACAGAATCAAGTTTGCCTCCAGTCGGGAAACTGCCCTT
box_v5_D E 03 c5.0.3.49 CACCGCCTGGCCCTGAGAGAGGCCCCAGCAGGCGAGAAAAAC
box_v5_D E 04 c5.0.3.50 CGTCTATATCACCCAAATCAATGGCAAGTGTAGCGCGCCGCG
box_v5_D E 05 c5.0.3.51 CTTAATGGTGTTTTTATAATCGTCCATCACGCAAAATACCTA
box_v5_D E 06 c5.0.3.52 CATTTTGTTACATTGGCAGATCCTAAAACATCGCCCAGAAGA
box_v5_D E 07 c5.0.3.53 TAAAACAACAGTTGAAAGGAATAGGAGCACTAACATGCGGAA
box_v5_D E 08 c5.0.3.54 CAAAGAACATATTCCTGATTAACGTCAGATGAATAGAGAAAC
box_v5_D E 09 c5.0.3.55 AATAACGATTACCTTTTTTAATGGAAAC
box_v5_D E 10 c5.0.3.56 ATCAATAGAAAATTCATATGGACCAGTAGCACCATTCCAGTT
box_v5_D E 11 c5.0.3.57 TGGAACAATAAATCAAAAGAATAGCCCG
box_v5_D E 12 c5.0.3.58 GTGTTGTTACCATT
box_v5_D F 01 c5.0.3.59 ACGCAGTAATATTG
box_v5_D F 02 c5.0.3.60 TAAGCAGATAGCCGAACAAAGAAAGACACCACGGAGGCGAAC
box_v5_D F 03 c5.0.3.61 GTGGCGACTAAAGGGAGCCCCCGATTTA
box_v5_D F 04 c5.0.3.62 GAAAGCCATAAGTT
box_v5_D F 05 c5.0.3.63 AGAGATAATGATTA
box_v5_D F 06 c5.0.3.64 CAGAGAGAATAACATAAAAACTAGCTATCTTACCGACAGGAG
box_v5_D F 07 c5.0.3.65 GCCGATTTATAACGTGCTTTCCTCGTTA
box_v5_D F 08 c5.0.3.66 GAGCTAAAAGCCCT
box_v5_D F 09 c5.0.3.67 TTTGCCAAATTGAG
box_v5_D F 10 c5.0.3.68 TTGAAGCCTTAAATCAAGATTGTTTAACGTCAAAATAATATC
box_v5_D F 11 c5.0.3.69 CAGAACACTTGCCTGAGTAGAAGAACTC
box_v5_D F 12 c5.0.3.70 TTGCTGGATGAAAA
box_v5_D G 01 c5.0.3.71 ACCGCGCGCGTCTT
box_v5_D G 02 c5.0.3.72 CTGTCTTTCCTTATCATTCCACGTTTTAGCGAACCGTGGCAC
box_v5_D G 03 c5.0.3.73 AGACAATACAGAGATAGAACCCTTCTGA
box_v5_D G 04 c5.0.3.74 AGAATACTCCCGAC
box_v5_D G 05 c5.0.3.75 AGAACGCTTTCATC
box_v5_D G 06 c5.0.3.76 CATTTTCGAGCCAGTAATAAGTTTACGAGCATGTACTTGCTG
box_v5_D G 07 c5.0.3.77 AACCTCACGCTGAGAGCCAGCAGCAAAT
box_v5_D G 08 c5.0.3.78 GCATCACGAAACCA
box_v5_D G 09 c5.0.3.79 ATACAAACAACATG
box_v5_D G 10 c5.0.3.80 TTTGAAATACCGACCGTGTGATTTAACAACGCCAATTAAATC
box_v5_D G 11 c5.0.3.81 CTTTGCCTTAGAAGTATTAGACTTTACA
box_v5_D G 12 c5.0.3.82 ACTCGTACATGTAA
box_v5_D H 01 c5.0.3.83 AAATGCTGTTTAGT
box_v5_D H 02 c5.0.3.84 ACGCTGAGAAGAGTCAATAGTAGTTAATTTCATCTCAAAATT
box_v5_D H 03 c5.0.3.85 ATTTGCATTATACTTCTGAATAATGGAA
box_v5_D H 04 c5.0.3.86 ACCATATTCTGACC
box_v5_D H 05 c5.0.3.87 AATATATGGGTTAT
box_v5_D H 06 c5.0.3.88 AAAGAAGAGCGATA
box_v5_D H 07 c5.0.3.89 ACATCGGTACAGTA
box_v5_D H 08 c5.0.3.90 TTATCATACCACCA
box_v5_D H 09 c5.0.3.91 ATATCTTTTGAGGA
box_v5_D H 10 c5.0.3.92 CCACCAGATTAAAA
box_v5_D H 11 c5.0.3.93 GGATTATACGCTCA
box_v5_D H 12 c5.0.3.94 AGAGTCTAGTGAGG
box_v5_E A 01 c5.0.3.95 CCACACCGTCACGC
box_v5_E A 02 c5.0.3.96 GTGAACCCAGGGCG
box_v5_E A 03 c5.0.3.97 CTGGTTTTTGCAGC
box_v5_E A 04 c5.0.3.98 GGCGCCAAGAGGCG
box_v5_E A 05 c5.0.4.1 ATAAATCGTGTTGTTCCAGTTTGGAACAAGAGTCCGTAAAGC
box_v5_E A 06 c5.0.4.2 GCCGGAAGCAGGTCGACTCTAAGGGGGATGTGCTGCGGAAAC
box_v5_E A 07 c5.0.4.3 TCATTTTTTTACAAACAATTCAAATGAAAAATCTAGATAAAA
box_v5_E A 08 c5.0.4.4 ATCAATAGATAAAAATTTTTAGAACCCTCATATATATTAGCA
box_v5_E A 09 c5.0.4.5 GGTATTAAATATCCCATCCTAATTTACGAGCATGTCGAGCCA
box_v5_E A 10 c5.0.5.1 GCCGCCATTGATATTCACAAACAAATAAATCCTCATCTGAAT
box_v5_E A 11 c5.0.5.2 ATTTACATTTTGCGGGATCGTGAAGTTTCCATTAAACGGGTA
box_v5_E A 12 c5.0.5.3 TGGATAGCGATAAAAACCAAAATAGCGAGAGGCTTACAACAT
box_v5_E B 01 c5.0.5.4 AAAGAAAAATGAATTTTCTGTTCACCAGTACAAACTACAACG
box_v5_E B 02 c5.0.5.5 TCATTTGTTCTGCGAACGAGTGGTCATTTTTGCGGACCAGAC
box_v5_E B 03 c5.0.6.1 CCGCCTCGACGACGACAATAAATTCTTACCAGTATAAAGCCA
box_v5_E B 04 c5.0.6.2 GCATCGGCCTACATTTTGACGACCGCCAGCCATTGCAACAGG
box_v5_E B 05 c5.0.6.3 GAGAAAGCCCCAAAAACAGGAGTAAACGTTAATATGGATTCT
box_v5_E B 06 c5.0.7.1 GCCCTTTATAATAAGAGCAAGCAAAAATGAAAATATTATCCC
box_v5_E B 07 c5.0.7.2 ATTTTAAAACACCAGAACGAGCAGGCGAAAATCCTTGGACTC
box_v5_E B 08 c5.0.7.3 TTTGAGTACCTACCATATCAAAATTATT
box_v5_E B 09 *****
box_v5_E B 10 *****
box_v5_E B 11 *****
box_v5_E B 12 *****
box_v5_E C 01 *****
box_v5_E C 02 *****
box_v5_E C 03 *****
box_v5_E C 04 *****
box_v5_E C 05 *****
box_v5_E C 06 *****
box_v5_E C 07 *****
box_v5_E C 08 *****
box_v5_E C 09 *****
box_v5_E C 10 *****
box_v5_E C 11 *****
box_v5_E C 12 *****
box_v5_E D 01 *****
box_v5_E D 02 *****
box_v5_E D 03 *****
box_v5_E D 04 *****
box_v5_E D 05 *****
box_v5_E D 06 *****
box_v5_E D 07 *****
box_v5_E D 08 *****
box_v5_E D 09 *****
box_v5_E D 10 *****
box_v5_E D 11 *****
box_v5_E D 12 *****
box_v5_E E 01 *****
box_v5_E E 02 *****
box_v5_E E 03 *****
box_v5_E E 04 *****
box_v5_E E 05 *****
box_v5_E E 06 *****
box_v5_E E 07 *****
box_v5_E E 08 *****
box_v5_E E 09 *****
box_v5_E E 10 *****
box_v5_E E 11 *****
box_v5_E E 12 *****
box_v5_E F 01 *****
box_v5_E F 02 *****
box_v5_E F 03 *****
box_v5_E F 04 *****
box_v5_E F 05 *****
box_v5_E F 06 *****
box_v5_E F 07 *****
box_v5_E F 08 *****
box_v5_E F 09 *****
box_v5_E F 10 *****
box_v5_E F 11 *****
box_v5_E F 12 *****
box_v5_E G 01 *****
box_v5_E G 02 *****
box_v5_E G 03 *****
box_v5_E G 04 *****
box_v5_E G 05 *****
box_v5_E G 06 *****
box_v5_E G 07 *****
box_v5_E G 08 *****
box_v5_E G 09 *****
box_v5_E G 10 *****
box_v5_E G 11 *****
box_v5_E G 12 *****
box_v5_E H 01 *****
box_v5_E H 02 *****
box_v5_E H 03 *****
box_v5_E H 04 *****
box_v5_E H 05 *****
box_v5_E H 06 *****
box_v5_E H 07 *****
box_v5_E H 08 *****
box_v5_E H 09 *****
box_v5_E H 10 *****
box_v5_E H 11 *****
box_v5_E H 12 *****