Build-a-Gene Session 2

This week we will be checking to see whether in week 1 we were able to successfully use template-dependent PCR to amplify the DNA parts that will allow the emerald GFP gene to be expressed in cells. We will also be designing and assembling the coding sequence for the emerald GFP.

Gel electrophoresis

We need to check whether in week 1 we were able to successfully use template-dependent PCR to amplify the DNA parts that will allow the emerald GFP gene to be expressed in cells. We can tell how well our PCR reactions worked by running our PCR products on an agarose gel. If we see a strong DNA band, it will verify that we have amplified a significant amount of the promoter and vector sequences. A helpful animation on gel electrophoresis: [1]

Pouring a Gel:

1. Weigh out 0.5 g of agarose on a piece of weigh paper. Transfer to an Erlenmeyer flask. Add 50 ml of 1x TAE.
2. Place the flask in the microwave and heat until the agarose is completely transparent and colorless. You may need to remove the flask from the microwave and swirl the mixture a few times.
3. Remove the flask of clear agarose and allow it to cool. This will take about 10 min.
4. While the agarose is cooling, place the gel tray into the gel box and add the comb.
5. When the agarose is cool, add Gel Red to the melted agarose.
6. Swirl the agarose to incorporate the Gel Red and pour the agarose into the gel tray.
7. Allow at least 20 minutes for the gel to solidify. Once solid, carefully remove the comb and place the solidified gel into the gel box so that the wells are oriented on the same side as the black electrode.
8. Add enough 1x TAE buffer to completely cover the gel by about 1 cm.

Preparing your samples:

1. Transfer each of your PCR products to a new tube and label each tube with the sample name and your initials. Be sure to include your control.
2. On a piece of parafilm, spot out 2 ul of 5x DNA loading dye with a P20 pipet. You will need three spots.
3. Add 3 ul of water to each spot of dye.
4. Add 5 ul of one of the PCR products to each spot of dye.

Running a Gel:

1. Into the first lane of the gel load 9 ul of the DNA ladder (mixed with water and dye).
2. Into lanes 2-3, load 9 ul of each of your PCR product and control (mixed with water and dye).
3. Place gel lid with electrodes on gel box, and turn on the voltage.
4. Run gel approximately 30 minutes or until the dye is 2/3 of the way down the gel, then take picture.

Template-independent PCR

We use template-independent PCR (also called Polymerase Cycling Assembly or Assembly PCR) to assemble the oligonucleotides (small pieces of DNA ~60 nucleotides long) into the full-length emGFP gene. The Wikipedia site offers a useful introduction to Polymerase Cycling Assembly: [2]

Reaction Setup

• Keep the master mix on ice AT ALL TIMES!
• When each reagent has thawed, mix briefly by pipetting up and down several times.

1. Create your reaction mix by combining all reagents listed below into one PCR tube (these are the small thin-walled tubes).

Reagent	T-PCR for emGFP gene
PCR master mix (contains buffer, enzyme and nucleotides)	20 ul
Primers (oligonucleotides)	5 ul of emGFP primer mix
Total	25 ul

2. Cap your tubes and make sure that they are sealed tightly so that the liquid will not evaporate.

3. Place your tubes in the PCR machine in the position for which you signed up.

Reaction Conditions:

94oC, 3 minutes
55oC, 30 seconds
72oC, 1 minute

5 cycles:

       94oC, 30 seconds
       69oC, 30 seconds
       72oC, 1 minute

5 cycles:

       94oC, 30 seconds
       65oC, 30 seconds
       72oC, 1 minute

20 cycles:

       94oC, 30 seconds
       61oC, 30 seconds
       72oC, 1 minute

72oC, 3 minutes

Template-dependent PCR

The template-independent PCR was used to assemble oligonucleotides into the full-length emGFP gene. But, the abundance of that full-length emGFP gene is very low and it is in a mixture with many other smaller intermediates that did not complete assembly to the full-length gene. To complete the synthesis of the emGFP gene, we must therefore exponentially amplify the desired DNA sequence so that most of the DNA present in the mixture following this second PCR step will be the full-length emGFP gene. A good introduction to PCR is here:[3]

Reaction Setup

• Keep the master mix on ice AT ALL TIMES!
• When each reagent has thawed, mix briefly by pipetting up and down several times.

1. Obtain your template-independent PCR reaction from the PCR machine.
2. Create your reaction mix by combining all reagents listed below into a PCR tube.

Reagent	emGFP PCR	Control PCR
PCR master mix (contains buffer, enzyme and nucleotides)	18 ul	18 ul
Primers	5 ul of emGFP primer mix	5 ul of water
DNA template	Add 2 ul of the template-independent PCR reaction	Add 2 ul of the template-independent PCR reaction
Total	25 ul	25 ul

3. Vortex briefly so that your reaction mix is completely mixed. Cap your tubes and make sure that they are sealed tightly so that the liquid will not evaporate. Place your tubes in the PCR machine in the position for which you signed up. Make sure that you have recorded which sample (the emGFP gene PCR or the control PCR) is in each position in the PCR machine.

Reaction Conditions:

94oC, 3 minutes

35 cycles:

       94oC, 30 seconds
       55oC, 30 seconds
       68oC, 1 minute

68oC, 3 minutes

Designing oligonucleotides to construct the Emerald GFP gene

Our goal is to build the emGFP (emerald green fluorescent protein) gene, which codes for the emGFP protein, which makes cells glow green. To break our sequence into oligonucleotides, we use the program GeneDesign [4]

1.To begin, we start with the sequence of emGFP.

ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGC CCGTGCCCTGGCCCACCCTCGTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGAC CCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAG GTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATC ACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

2.Rather than ordering one piece of DNA that is the length of our gene (~750 bp), we order our DNA as oligonucleotides of approximately 60 bp. From the GeneDesign homepage, click “Building Block Design (restriction site overlap)”.

Make sure the settings are:
“Target oligo length” of 60 bp
“Overlap melting temperature” of 56deg
Make sure that “generate gapped oligos” is selected
Make sure that “maximum allowable oligo length” is set to 60

Click “Design oligos”. Notice that in the second white box at the top you see four DNA strands: the top and bottom strands are the two complete strands of the final assembled gene and in between them you see the overlapping oligos that can be used to synthesize the gene.

3.Click “FASTA format: Assembly oligos” and the program will provide you with a list of the oligos that can be used to synthesize your designed emGFP gene. These oligos have been ordered from a commercial DNA synthesis company and have been combined together to create the "emGFP primer mix" that we used in the template-independent PCR above.