Biomod2015pknu/DNA structure

From OpenWetWare
Jump to: navigation, search

150922

  • Sequence: CCAAGCTTGGACTTCAGGCCTGAAGTGGTCATTCGAATGACCTGAGCGCTCA
- CCA AGC TTG GAC TTC AGG CCT GAA GTG GTC ATT CGA ATG ACC TGA GCG CTC A
  • reference
- Approaching The Limit: Can One DNA Oligonucleotide Assemble into Large Nanostructures? http://onlinelibrary.wiley.com/doi/10.1002/anie.200504022/abstract