Biomod/2014/Folding

From OpenWetWare
Jump to: navigation, search

<html>

<head>
 <title> Mainpage </title>
  <style>
    body{
    align: left;
    width: 1200px;
    height: auto;
    margin: 0 auto;
    background-color:#be1e3c;
    border:#be1e3c thin solid;
    }
    #goTopBtn {POSITION: fixed;TEXT-ALIGN: center;LINE-HEIGHT: 30px;WIDTH: 100px;BOTTOM: 35px;HEIGHT: 100px;FONT-SIZE: 12px;RIGHT: 30px;}
    #content{margin:0;padding:0;border:0px;}
      /*hidden section*/
      .firstHeading{display:none;}
      #sidebar-main{display:none;}
      #p-cactions{display:none;}
      #p-personal{display:none;}
   </style>
</head>
<body>
 <center>
  
  <table align="center" border="0">
   <colgroup  span="4"></colgroup>
    <tr>
     <th>
       <a href="http://www.tu-braunschweig.de/index.html"><img src="http://openwetware.org/images/thumb/2/27/Nanoscooter_TUBS-siegel.jpg/800px-Nanoscooter_TUBS-siegel.jpg" width="383" height="142" alt="Logo TU Braunschweig"></a>      
     </th>
     <th>
      <img src="http://openwetware.org/images/thumb/c/c3/Nanoscooter_Gruppenfoto-Banner.jpg/800px-Nanoscooter_Gruppenfoto-Banner.jpg"
       width="463" height="142"
       alt="our group"
       title="our group (Nanoscooter) for Biomod competition">
     </th>
     <th><img src="http://openwetware.org/images/2/24/Nanoscooter.jpg"
        width="165" height="142" alt="Logo Nanoscooter">  </th>
  </table>


<h1> Team Nanoscooter Braunschweig </h1>

<table border="0">

  <colgroup width="158" span="6"></colgroup>
   <tr>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="Braunschweig"><span style="color:white">Home</span></a></font></center></th>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="Team"><span style="color:white">Team</span></a></font></center></th>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="idea"><span style="color:white">Project idea</span></a></font></center></th>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="results"><span style="color:white">Results</span></a></font></center></th>     
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="perspectives"><span style="color:white">Perspectives</span></a></font></center></th>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="Sponsoren"><span style="color:white">Sponsoring</span></a></font></center></th>
   </tr>

</table>

<br><br> <table> <colgroup>

   <col width="200px">
   <col width="800px">
   <col width="200px">
 </colgroup>

<tr> <td align="left" valign="top">

  <style type="text/css">

body { height:500px; } div { }

  1. f1 { position:fixed; top:450px; left:"200"; width:110px; height:100px; background-color:transparent; }

</style> <body> <div id="f1"><a href="Braunschweig"><img src="http://openwetware.org/images/b/bf/Zur%C3%BCckpfeil.png"

        width="103" height="88" alt="Back"align="left"></a></div>

</body> </td> <td> <font size="+2pt"><u>DNA Origami Folding</u></font> <br><br> <p align="justify"; style="line-height:2em"><font size="3pt"> DNA origamis were assembled with a tenfold excess of the staple strands with respect to the scaffold strand <br>(1 pmol, p8064) in 1xTE buffer containing MgCl<sub>2</sub> and using a thermocycler.<br><br> For the list of the different master mixtures used and staple sequences see <a href="CACGTAATTGACGCCAGCTTTGAAT">here</a>.</font> </p><br><br>

<font size="+1pt">Gel electrophoresis</font> <br> <p align="justify"; style="line-height:2em"><font size="3pt"> 0.75 g of agarose were added to 50 mL 0.5X TBE buffer and heated for 2 min in the microwave. After cooling down 2 µL Sybr® Safe DNA Gel Strain and 800 µL 1 M aqueous MgCl<sub>2</sub> solution were added to the agarose gel.<br><br> 30 µL sample was mixed with 5 µL 10X BlueJuice™ Gel Loading Buffer and loaded onto the gel. As a reference, 30 µL p8064 scaffold (10 nM) also with 5 µL 10X BlueJuice™ Gel Loading Buffer were applied. Furthermore, GeneRuler 1 kb Plus DNA Ladder was used as a marker.<br><br> The gel electrophoresis was carried out in TBE with 11 mM MgCl<sub>2</sub> as running buffer for 90 min. <br><br> </font></p>

<font size="+1pt">Gel extraction</font><br> <p align="justify"; style="line-height:2em"><font size="3pt"> The gel was examined under UV and the bands corresponding to successfully folded origami were cut. The DNA origami solution was extracted through gently squeezing the gel fragment on a clean parafilm surface. <br><br> </font></p> <font size="+1pt">Filtering</font><br> <p align="justify"; style="line-height:2em"><font size="3pt"> If the samples were not subjected to gel electrophoresis, filtering with an Amicon filter system (centrifugation 100k, 5 minutes, 10k rcf) was used to remove excess staple strands. The filtering was carried out 3 times with folding buffer.<br><br> The DNA origami solution was regained from the filter by centrifugation for 3 minutes at 1k rcf. <br><br> </font></p>

<font size="+1pt">Determining the optimal folding program</font><br> <p align="justify"; style="line-height:2em"><font size="3pt"> From the literature it is known that DNA origamis fold well when subjected to a thermal ramp,<sup>[1]</sup> cooling down the mixture of staple strands and scaffold from a high temperature (> 60 °C) to room temperature over a certain thermal ramp. For every new DNA origami, folding conditions have to be optimized. Therefore, we subjected the DNA origami folding mix containing all staples (100 nM each), scaffold p8064 (10 nM), 16 mM MgCl<sub>2</sub> in TE buffer to different folding programs(3DO, 24HF and 60HF, respectively). <br><br></font></p> <div align="center"><img src="http://openwetware.org/images/thumb/c/c6/Folding_programs_final.png/800px-Folding_programs_final.png" width="75%" height="75%" ></div> <br> <i><font size="3 "><div align="center">Figure 1: Thermal ramps of the used folding programs.</font></i></div> <br><br> <p align="justify"; style="line-height:2em"><font size="3pt"> Afterwards, the samples were subjected to gel electrophoresis (Figure 2). <br><br> </font></p>

<div align="center"><img src="http://openwetware.org/images/8/87/Gel_folding_programs_final.png" width="" height="" ></div> <br>

<i><font size="3 "><div align="center">Figure 2: Gel electrophoresis for testing different folding conditions. Lanes (from left): lane 1: 3DO; lane 2: 60HF; lane 3: 24HF; lane 4: p8064 scaffold as reference; lane 5: GeneRuler 1 kb Plus DNA Ladder as a marker.</font></i></div> <br><br>

<p align="justify"; style="line-height:2em"><font size="3pt"> All three folding programs give rise to a sharp band. The sharp band in lane 4, which contains scaffold only, runs slower than the bands in the 1<sup>st</sup>-3<sup>rd</sup> lanes, which show the mobility of the DNA origami. Therefore we are certain that DNA origami folding took place in all three programs. Since the intensity is highest in lane 3, for all further experiments we used the folding program 24HF. <br><br> </font></p>

<font size="+1pt">Determining the optimal Mg<sup>2+</sup> concentration for folding</font><br> <p align="justify"; style="line-height:2em"><font size="3pt"> Since the folding is strongly dependent on the Mg<sup>2+</sup> concentration, we screened different Mg<sup>2+</sup> concentrations for best folding efficiency. DNA origami folding mixtures with different Mg<sup>2+</sup> concentrations varying between 6 mM and 30 mM were subjected to the folding program 24HF and analyzed with gel electrophoresis, as shown in Figure 3.<br><br> Since the gel doesn’t show a clear tendency towards which concentration is best suited for the folding of the Nanoscooter, we further analyzed the samples with AFM. Figure 3 shows the difference between the Nanoscooter which was folded with the MgCl<sub>2</sub> concentrations of 6 and 18 mM. Obviously, the folding of the DNA origami with the latter concentration worked out best. <br><br></font></p>

<div align="center"><img src="http://openwetware.org/images/thumb/2/26/Gel_MgCl2_concentration_final.png/578px-Gel_MgCl2_concentration_final.png" width="" height="" ></div> <br>

<i><font size="3 "><div align="center">Figure 3: Gel electrophoresis monitoring the folding process with different MgCl<sub>2</sub> conentrations 1st lane: GeneRuler 1 kb Plus DNA Ladder as a marker; 2<sup>nd</sup>-9<sup>th</sup> lane: variation of the MgCl<sub>2</sub> concentration; 10th lane: 8064 base pairs DNA scaffold as standard sample.</font></i></div> <br><br>

<p align="justify"; style="line-height:2em"><font size="3pt"> Summing up, we successfully folded the new DNA origami and optimized the conditions. Best results are obtained by using a Mg<sup>2+</sup> concentration of 18 mM and the folding program 24HF. This now opens the way to use the Nanoscooter for all subsequent experiments. <br><br></font></p> <hr style="background-color:#be1e3c;"> <table> <tr><td><font size="2pt"><p align="justify"> [1]</font></td> <td><font size="2pt">P. Rothemund: <i>Folding DNA to create nanoscale shapes and patterns</i>, Nature,<b> 2006</b>, <i>440</i>, 297-302.</font></td></tr> </table><td></td></table> </body>


</html>