Biomod/2014/CACGTAATTGACGCCAGCTTTGAAT

From OpenWetWare
Jump to: navigation, search

<html>

<head>
 <title> Mainpage </title>
  <style>
    body{
    align: left;
    width: 1200px;
    height: auto;
    margin: 0 auto;
    background-color:#be1e3c;
    border:#be1e3c thin solid;
    }
    #goTopBtn {POSITION: fixed;TEXT-ALIGN: center;LINE-HEIGHT: 30px;WIDTH: 100px;BOTTOM: 35px;HEIGHT: 100px;FONT-SIZE: 12px;RIGHT: 30px;}
    #content{margin:0;padding:0;border:0px;}
      /*hidden section*/
      .firstHeading{display:none;}
      #sidebar-main{display:none;}
      #p-cactions{display:none;}
      #p-personal{display:none;}
   </style>
</head>
<body>
 <center>
  
  <table align="center" border="0">
   <colgroup  span="4"></colgroup>
    <tr>
     <th>
       <a href="http://www.tu-braunschweig.de/index.html"><img src="http://openwetware.org/images/thumb/2/27/Nanoscooter_TUBS-siegel.jpg/800px-Nanoscooter_TUBS-siegel.jpg" width="383" height="142" alt="Logo TU Braunschweig"></a>     
     </th>
     <th>
      <img src="http://openwetware.org/images/thumb/c/c3/Nanoscooter_Gruppenfoto-Banner.jpg/800px-Nanoscooter_Gruppenfoto-Banner.jpg"
       width="463" height="142"
       alt="our group"
       title="our group (Nanoscooter) for Biomod competition">
     </th>
     <th><img src="http://openwetware.org/images/2/24/Nanoscooter.jpg"
        width="165" height="142" alt="Logo Nanoscooter">  </th>
  </table>


<h1> Team Nanoscooter Braunschweig </h1>

<table border="0">

  <colgroup width="158" span="6"></colgroup>
   <tr>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="Braunschweig"><span style="color:white">Home</span></a></font></center></th>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="Team"><span style="color:white">Team</span></a></font></center></th>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="idea"><span style="color:white">Project idea</span></a></font></center></th>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="results"><span style="color:white">Results</span></a></font></center></th>     
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="perspectives"><span style="color:white">Perspectives</span></a></font></center></th>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="Sponsoren"><span style="color:white">Sponsoring</span></a></font></center></th>
   </tr>

</table>

<br><br> <table> <colgroup>

   <col width="100px">
   <col width="1000px">
   <col width="100px">
 </colgroup>

<tr><td></td><td> <font size="+2" valign="top"><u>Materials</u></font> <p align="justify"; style="line-height:2em"><font size="3pt"> The chemicals were purchased from Sigma Aldrich, oligonucleotides from MWG Eurofins, yellow green fluorescent beads and 10X BlueJuice™ Gel Loading Buffer from Life Technologies and Pt-nanoparticles from Nanocomposix.</font></p> <br><br>

<center> <i><font size="3 "><div align="center">Table 1: Buffer list.</font></i><br><br> <table frame="box" rules="all" style="font-size:12pt"> <tr><th>Buffer</th><th>Ingredients</th></tr> <tr><td align="left" valign="top">1X TE</td><td>10 mL 1 M Tris-HCl (pH 8)<br> 2 mL 0.5 M EDTA (pH 8)<br> 988 mL water </td></tr>

<tr><td align="left" valign="top">10X TE</td><td>100 mL 1 M Tris (pH 8)<br> 20 mL 0.5 M EDTA (pH 8)<br> 880 mL water </td></tr>

<tr><td align="left" valign="top">PBS</td><td>8.0 g NaCl<br> 0,2 g KCl<br> 1.42 g Na<sub>2</sub>HPO<sub>4</sub><br> 1.78 Na<sub>2</sub>HPO<sub>4</sub>• 2 H<sub>2</sub>O<br> 0,27 g KH<sub>2</sub>PO<sub>4</sub><br> 1000 mL water </td></tr>


<tr><td align="left" valign="top">TBE</td><td> 10.8 g Tris<br> 5.5 g boric acid<br> 0.7 g Na<sub>2</sub>EDTA<br> 1000 mL water </td></tr>

<tr><td align="left" valign="top">TAE</td><td> 4.84 g Tris<br> 1.1 mL acetic acid<br> 2 mL 0.5 M Na<sub>2</sub>EDTA<br> 997 mL water </td></tr>

<tr><td align="left" valign="top">Phosphate buffer</td><td> 400 mL 1 M KH<sub>2</sub>PO<sub>4</sub> solution<br> 500 mL 1 M K<sub>2</sub>HPO<sub>4</sub> solution </td></tr>

<tr> <td align="left" valign="top"> <font size="3pt">LB medium</td>

   <td>>10 g/L NaCl<br>

10 g/L Bacto-tryptone<br> 5 g/L Yeast extract<br> in ddH<sub>2</sub>O, autoclave</td> </tr> <tr><td align="left" valign="top"><font size="3pt">DYT medium</td>

   <td>16 g/L Bacto-tryptone<br>

10 g/L Yeast extract<br> 5 g/L NaCl<br> in ddH<sub>2</sub>O, autoclave</td> </tr> <tr><td align="left" valign="top"><font size="3pt">Buffer M1</td>

   <td>150 g PEG-8000/500 mL<br>

87.66 g NaCl/500 mL<br><br></td> </tr> <tr><td align="left" valign="top"><font size="3pt">10mM Tris</td>

   <td>121.14 mg Tris base /100 mL<br>

Adjust to pH 8.5 with HCl<br><br></td> </tr> <tr><td align="left" valign="top"><font size="3pt">Buffer PPB2</td>

   <td>1.6 g NaOH/200 mL<br>2 g SDS/200 mL</td>

</tr> <tr><td align="left" valign="top"><font size="3pt">Buffer PPB3</td>

   <td>58.88 g C<sub>2</sub>H<sub>3</sub>KO<sub>2</sub>/200 mL<br>Adjust pH to 5.5 with glacial acetic acid</td>

</tr>


</table></center><br><br>

<font size="+1" valign="top">DNA Origami Folding</font> <p align="justify"; style="line-height:2em"><font size="3pt"> Supporting information.</p></font> <br>

<center> <i><font size="3 "><div align="center">Table 2: Staples for Mastermixtures.</font></i><br><br> <table frame="box" rules="all" style="font-size:12pt"> <tr> <th>Mastermix</th><th>Staples used for the unmodified Nanoscooter</th><th>Mastermix</th><th>Staples used for the Nanoscooter modified for <br>modified for platinum nanoparticle binding<br> platinum nanoparticle and bead binding</th></tr>

<tr><td align="left" valign="top">N1</td><td align="left" valign="top">unmodified staples: N1_A1 - N2_E9</td><td align="left" valign="top">N3</td><td>staples modified with 15 adenines:

rot1_15A - <br> orange3_15A</td></tr>

<tr><td align="left" valign="top">N2</td><td align="left" valign="top">unmodified staples:

rot1_unmod - orange3_unmod

</td><td align="left" valign="top">N4</td><td>unmodified staples N1_A1-N2_E9 without N1_B1,<br> N1_D8, N1_G9, N1_G11, N2_C7</td></tr>

<tr><td></td><td></td><td align="left" valign="top">N5</td><td>staples modified with 15 adenines: rot1_15A - <br> orange3_15A and biotin modified staples</td></tr></table></center>

<br><p align="justify"; style="line-height:2em"><font size="3pt"> The sequences are shown in the attached file (List of staples).<br><br></font></p>

<center> <i><font size="3 "><div align="center">Table 3: Components for DNA origami folding.</font></i><br><br> <table frame="box" rules="all" style="font-size:12pt"><tr><th>Components</th><th>unmodified Nanoscooter</th><th>Nanoscooter modified for <br>platinum nanoparticle binding</th><th>Staples used for the Nanoscooter modified for <br>platinum nanoparticle and bead binding</th></tr><tr><td></td><td>volume [µL]</td><td>volume [µL]</td><td>volume [µL]</td></tr>

<tr><td>Mastermix N1</td><td>32</td><td>32</td><td>-</td></tr>

<tr><td>Mastermix N2</td><td>10</td><td>-</td><td>-</td></tr>

<tr><td>Mastermix N3</td><td>-</td><td>10</td><td>-</td></tr>

<tr><td>Mastermix N4</td><td>-</td><td>-</td><td>30</td></tr>

<tr><td>Mastermix N5</td><td>-</td><td>-</td><td>10</td></tr>

<tr><td>MgCl<sub>2</sub> (100 mM)</td><td>18</td><td>18</td><td>18</td></tr>

<tr><td>MilliQ water</td><td>20</td><td>20</td><td>22</td></tr>

<tr><td>10x TE buffer</td><td>10</td><td>10</td><td>10</td></tr>

<tr><td>Scaffold p8064 (100 nM)</td><td>10</td><td>10</td><td>10</td></tr>

<table></center><tr><td><br><br>

<i><font size="3 "><div align="center">Table 4: List of staples.</font></i><br><br> <table frame="box" rules="all" > <tr><th> Oligoname </th><th> Sequence </th></tr>

<tr> <td> N1_A1 </td><td> CACGTAATTGACGCCAGCTTTGAAT </td></tr> <tr> <td> N1_A2 </td><td> CCGCTTTTGAGGCTTAGTAAAAGGAT </td></tr> <tr> <td> N1_A3 </td><td> GTGTACAAGAATCGCAACGCCAACATGT </td></tr> <tr> <td> N1_A4 </td><td> GGGTCGTAACCTAAGCCCGAAAGACTTC </td></tr> <tr> <td> N1_A5 </td><td> CAATAGAAAATTCAAGTTTATAAACGTCA </td></tr> <tr> <td> N1_A6 </td><td> AGCTTGCAGGTAGATTGGTCTTGATACCG </td></tr> <tr> <td> N1_A7 </td><td> ACGTAACTAACCTCATCTTTGACCCATTA </td></tr> <tr> <td> N1_A8 </td><td> TCACGGCGGATGGGATAGGTCACGTGGGCGC </td></tr> <tr> <td> N1_A9 </td><td> GCTTGACCATAACGCCTTTCACATCAAAAAT </td></tr> <tr> <td> N1_A10 </td><td> ACCGTCACCATTTGCATTACCCCTCAGAGCCG </td></tr> <tr> <td> N1_A11 </td><td> TACCCAATGAGCATGTAGTCCCTGACGAAACG </td></tr> <tr> <td> N1_A12 </td><td> AGTCAGGCATTTGTTTTGATACATTAAAATCA </td></tr> <tr> <td> N1_B1 </td><td> TGCGCGCCTGTTAGCCTTAGAACCCCTCAAAT </td></tr> <tr> <td> N1_B2 </td><td> TAAACCTTAGGTTGGGTAACACCGATAAATAAG </td></tr> <tr> <td> N1_B3 </td><td> AGTTTGCAGACTGTAGCGCGTATTTTCGTTCATAA </td></tr> <tr> <td> N1_B4 </td><td> AGCAACTTCAAAGATTGCTATCGAAACCGTATTAG </td></tr> <tr> <td> N1_B5 </td><td> AGGGAACTGATTTAGATACGAGACCTTATGCACTG </td></tr> <tr> <td> N1_B6 </td><td> CAGAGCAATCTAATAGAAACTAAAGTTTGAGTGAA </td></tr> <tr> <td> N1_B7 </td><td> TTAGCATATTAAATAACAACCAAGAATAGGGTTGA </td></tr> <tr> <td> N1_B8 </td><td> TACATCATCGAAATTGTGTCGAAATCCGCGACAAC </td></tr> <tr> <td> N1_B9 </td><td> GACAGCCGCGTAACCCGGCACCGCTTCTGGTGCCC </td></tr> <tr> <td> N1_B10 </td><td> CTCAAGTGGGACGAGGCCTCAGGAAGATCGCACTC </td></tr> <tr> <td> N1_B11 </td><td> ATAACGGAAAGATTTTGGCCGTCTCGTCCTCAAGG </td></tr> <tr> <td> N1_B12 </td><td> GGGCGCCTTCTTTTGAGGTGGAGTTTAAAAATACC </td></tr> <tr> <td> N1_C1 </td><td> GGTGTGTGTAAACTAACTCTAACGGCATGGTGCCC </td></tr> <tr> <td> N1_C2 </td><td> AATTACGTGAACCATCAGTTTTTTACCCTAACGAT </td></tr> <tr> <td> N1_C3 </td><td> CAAAGCGAAAGACAGCAGATCGTCCAAAAGAGAGGG </td></tr> <tr> <td> N1_C4 </td><td> CTTTCGCGCTTACGTGGTGCTGGAAGTTTCATTCCA </td></tr> <tr> <td> N1_C5 </td><td> ATAATGATTGCAAGTTACAATCGGCTTTCAAACTGC </td></tr> <tr> <td> N1_C6 </td><td> AGGCTAATTTACGCTAACGAGCGTCTGTACCGCTCATT </td></tr> <tr> <td> N1_C7 </td><td> AAAGAATGAACGGTATACCACTGCAGATACATAACATT </td></tr> <tr> <td> N1_C8 </td><td> TCTCAATCACCAGCTGGCAGCATTTCGGTCTGAAACAT </td></tr> <tr> <td> N1_C9 </td><td> GCTTTACTTAGCCGGAAGCAGACGTGAAAGAATGAACG </td></tr> <tr> <td> N1_C10 </td><td> AATATGGTTTAATTTCATTGTGAACCAACTTGTCAATC </td></tr> <tr> <td> N1_C11 </td><td> ACTAAAGCGCCGTGGCGGAGCTTGACGGGGAAGCACTA </td></tr> <tr> <td> N1_C12 </td><td> TCGTCTATCAGGGCGATGGCCCACCTCCAAAATAATAA </td></tr> <tr> <td> N1_D1 </td><td> GGAGCTTTCACACCAGTACAGCTGATTGCCCGGCCCTG </td></tr> <tr> <td> N1_D2 </td><td> AGAAAGGAGGACTCATTTAAGAGGCGTCGTTAAATCCT </td></tr> <tr> <td> N1_D3 </td><td> GAACAACGCTCCAATAGGCGAAAAAAATCCGTGCATCTG </td></tr> <tr> <td> N1_D4 </td><td> TTAGAGCTAAGTTACTCATGAATCCTGTAGCATTCCGCA </td></tr> <tr> <td> N1_D5 </td><td> GCGTGGTGTACGGTGTGTCATTCACGCTGCGGCCACGAT </td></tr> <tr> <td> N1_D6 </td><td> AACAGCATGCCCTGCTTTAAACAGTTCAGATGCCAAGTT </td></tr> <tr> <td> N1_D7 </td><td> GTCAGACGATTGGCCTTGATTATTTGCAAAATAAAAGAT </td></tr> <tr> <td> N1_D8 </td><td> AATGACAACACGTGGTTCTCACCGGCTTTAGCCACTGCAA </td></tr> <tr> <td> N1_D9 </td><td> GCCAGTAGACAGGCAAATTTCCATAGGGCTTAATTGGACC </td></tr> <tr> <td> N1_D10 </td><td> ACAAACTACAACGTTTTACCCATAGGAAGTACCCTCCGCC </td></tr> <tr> <td> N1_D11 </td><td> TATAACAGTTGATTCCCAATCTCAACAAAAGGGTGGAGACA </td></tr> <tr> <td> N1_D12 </td><td> ATTCGGTCATCGCCAATACTGCGGAATCTTAGACTTGTTTC </td></tr> <tr> <td> N1_E1 </td><td> TAATGCGAACCACCACAGGCGCTGCACAGCAGAAGGGTGAGG </td></tr> <tr> <td> N1_E2 </td><td> CAAAATGTAGCATGAATCGATACAAGGCCTACAACTAAAACA </td></tr> <tr> <td> N1_E3 </td><td> AAACAGGAGACGGGAGAATTAGAGTAATAGATTCATGTTTTA </td></tr> <tr> <td> N1_E4 </td><td> ACGCTGCGCGCTGGCGGATCGAGGGCGTCAGTATTGCAACAG </td></tr> <tr> <td> N1_E5 </td><td> AAGGAAAACAAGAGGTATTAAATTGCCCGTTAACATATTCCT </td></tr> <tr> <td> N1_E6 </td><td> TGAGTGAAAAACAGATGGATTATTCATTCATTACATTTAACA </td></tr> <tr> <td> N1_E7 </td><td> CCAGAGCTCATTGCGGAGCAATTTAATTCGGTGCCCTGGGAG </td></tr> <tr> <td> N1_E8 </td><td> TCTCGTCGAGTTCCGACTTCAATCAAAATCTGGCCCCCCTCA </td></tr> <tr> <td> N1_E9 </td><td> CGGAGCTAGCGGTTGCGCTCAGCCAACGAGCGCCAACCGGAA </td></tr> <tr> <td> N1_E10 </td><td> ACAATCGCCTAAAACAGGCCAACGACTCGCCATTAACGAACC </td></tr> <tr> <td> N1_E11 </td><td> ATATGTTGCAGTTAGCGTTTGGATAAGAATGATGCCACCACC </td></tr> <tr> <td> N1_E12 </td><td> TAGTTAATACAGCAAACGTTTCAAACTTTAGAGCGCAACCAA </td></tr> <tr> <td> N1_F1 </td><td> AAAAAATCCCGTAAGGGTAAAGCGGTCCCAGAGCAAACGTCA </td></tr> <tr> <td> N1_F2 </td><td> AATTAGACAGGAACCCAGAATGTTTTTAGTGAGGCAAGAGTC </td></tr> <tr> <td> N1_F3 </td><td> GTGATTAAGTTTGTAAAGTGCCAATAACCTCTGTTTACCAGT </td></tr> <tr> <td> N1_F4 </td><td> CAGAAACAGGATTAAAGGGATTCATACGAGCTTAATTGAGAC </td></tr> <tr> <td> N1_F5 </td><td> GGAACAAGGTAGAAAGATTCATTTAGGAAATACGAGCCACTC </td></tr> <tr> <td> N1_F6 </td><td> GGTCAGTACAGTGCCCGCATTGAAGCGTATAAACACCTGCCT </td></tr> <tr> <td> N1_F7 </td><td> ACTACCTTTTATCAAACGCTGAGAAGAGTGCGATAGCTTAGA </td></tr> <tr> <td> N1_F8 </td><td> TAAGGCTATCAACGCAAGAACCAAATTCAAAGCCAACGCTCA </td></tr> <tr> <td> N1_F9 </td><td> GGAAGTTGTAATGTAATTGAGCGCTAATTGAACAATTTTCAT </td></tr> <tr> <td> N1_F10 </td><td> AGAGAGTTGCAGGTCCGGGCAGAGACGCGCGGTTTGCGTATT </td></tr> <tr> <td> N1_F11 </td><td> AGCACCGTGCCGGACTTGTAGCATCCTCAATTATCAGAAACC </td></tr> <tr> <td> N1_F12 </td><td> AGCCCAATGTACCGGAAAGGGCCTCTTCATCCTGTTTCCGAA </td></tr> <tr> <td> N1_G1 </td><td> ACAGCGGGCATCCCAGATACATTCTGTGCGCGCTCGCAAATG </td></tr> <tr> <td> N1_G2 </td><td> GTCGGGAGCCAGCTGGAATTTGTTTGATCCCGGGAGAGATAG </td></tr> <tr> <td> N1_G3 </td><td> AGCCATACAATCCAAATAAGAATGCCGGTATTTTTAAACTCC </td></tr> <tr> <td> N1_G4 </td><td> GTCAAATATGATATTCATTTTTGGAGCCTCCGTCGGATGGCT </td></tr> <tr> <td> N1_G5 </td><td> CTGCCAGCACGCGTGCCTGTTCTTCGCGTCCTCACCGTCTCG </td></tr> <tr> <td> N1_G6 </td><td> AATATGCAACTAAAGCTGGTCTGGGTAAGTGTAGTCAGCAGC </td></tr> <tr> <td> N1_G7 </td><td> ATCGGCAAAATCCCTTATAAATCAAATAGTCATAACGTCGGA </td></tr> <tr> <td> N1_G8 </td><td> AAAAATATTATAACCTGAAAATAGCAGCCTTTGTTTAACGTC </td></tr> <tr> <td> N1_G9 </td><td> TAGTAACCGGTCTGTTATATTTGGCAACAGGAAGATTGTAGT </td></tr> <tr> <td> N1_G10 </td><td> CTCCGGCGTTTTTTAGTTGAGATGGTCATAGCTGTAAATTGT </td></tr> <tr> <td> N1_G11 </td><td> CGCCAGGGTGTTAATTTTTTTTCCCAGTCCACCCTGATAGCA </td></tr> <tr> <td> N1_G12 </td><td> TCACGCAAATTAGGGCCGTTTACCGGGGGTAGTAACACCGTT </td></tr> <tr> <td> N1_H1 </td><td> ACAGTTTAGAATAGAACAAGCTATTTTCTCTTCCAGACGTTA </td></tr> <tr> <td> N1_H2 </td><td> CCATAACTAGTATGCATCAGAGAATGCGATCCCACCAACGGC </td></tr> <tr> <td> N1_H3 </td><td> AGTGAATTTTAACCTCCGGCACGGAATATATGGTTAAAGACAA </td></tr> <tr> <td> N1_H4 </td><td> TGATAGCGCCTATTAATGGGAAACGTACCGAACGTCGTATCGG </td></tr> <tr> <td> N1_H5 </td><td> AAAGCTATTACGTCGCGATAATCCAGCTGGCTAACACTACCAGT </td></tr> <tr> <td> N1_H6 </td><td> ACGATTCCATTACTAAAGACTTTTTAACGAGGTAAAAACAGAGG </td></tr> <tr> <td> N1_H7 </td><td> CCAGACAGGAGGAAGAATTTTTTTAAAGCCATTTCTTTCCCTGCG </td></tr> <tr> <td> N1_H8 </td><td> CCAGTTTTGTCGTCTATAATAGCAATATAGAGGTATTCAGGCGTT </td></tr> <tr> <td> N1_H9 </td><td> TACGGGAGAATCCTGATTGTTTGGTGAATAAAGAACCTAATATTC </td></tr> <tr> <td> N1_H10 </td><td> AAACTAAATTCAATAGTTACACATTAACAGTACCTTTAATAATCT </td></tr> <tr> <td> N1_H11 </td><td> GACCAGTAGAGTAGCACGGAATTAGAGCCAGAAAGGTGTAAATAT </td></tr> <tr> <td> N1_H12 </td><td> GGAGAGTACAGGGCGCGTACTATGGTTACGAGCAGCTTTCCGAAT </td></tr> <tr> <td> N2_A1 </td><td> TCATATGCGTACTAGAAAAGAATATATATAAATGCTGATGCAAAT </td></tr> <tr> <td> N2_A2 </td><td> CAGAGCATTAGCAACGGGTTACCCGAGCGGGCGTGGCTGGTAATA </td></tr> <tr> <td> N2_A3 </td><td> TAATTTAGCGCAAAAACGCGCAACTAAGAATCAAAAAGAAAGCCC </td></tr> <tr> <td> N2_A4 </td><td> AGGTAATATGCCGTTCCGAGAAGTCCTGAGCTCGAATTTCCACAC </td></tr> <tr> <td> N2_A5 </td><td> TAAGCCACCACATTAGCAAGCAGCATTAATTAATTTTCCGACATTC </td></tr> <tr> <td> N2_A6 </td><td> CGGGCGCAAGGGAATGCGGAAACCAGGCGTTGGGAGTGCGGGGGAT </td></tr> <tr> <td> N2_A7 </td><td> AAGTGTGTTCCTCAGGTCAGGATTAGAGCGGAAGCGAGAGATTATC </td></tr> <tr> <td> N2_A8 </td><td> TGAGAACTTAAATAGTCTCTGAGTTCTGCTCAGGGTTTTAGGCGGA </td></tr> <tr> <td> N2_A9 </td><td> GTAGCACTTAGGAAATGTTTTAAGCCGATGGGATTATTGAGGAAGG </td></tr> <tr> <td> N2_A10 </td><td> TAAGTGCGTTGATATAAGTATAGGTGTATCACCGTTTTAGTAGAAC </td></tr> <tr> <td> N2_A11 </td><td> CAGAAATCATAATTTAAAGAAAGAGCTACGGATATTAGGCTGAGTA </td></tr> <tr> <td> N2_A12 </td><td> AAACAAAATTAAAAATCACCAGCAAAAGAAGATGATTCATTTACAG </td></tr> <tr> <td> N2_B1 </td><td> ATAAGGGCTCCATGCAATAATTGAATTTATACCAGGGGAAGAGATT </td></tr> <tr> <td> N2_B2 </td><td> AATCGATCCCCGGGTACCGGCAAACGTTAAACGATGCTGCGACATA </td></tr> <tr> <td> N2_B3 </td><td> GAACAAAATAATCGTTTCCTTATCGCCCTACCGCAATCGTAATGTA </td></tr> <tr> <td> N2_B4 </td><td> GTAAAACAGGAAGTGGCATAGACTATCATAACCCTACGACGAGTAG </td></tr> <tr> <td> N2_B5 </td><td> ATTGAATCTTCCTGTCATCAACTTACGAGGAAACCAATTATCCAGGC </td></tr> <tr> <td> N2_B6 </td><td> CCCGCATTAATGAATCGCTGCCCGACTCACACGGAAGCTCACAATCGT </td></tr> <tr> <td> N2_B7 </td><td> CAAGATTATAAGCATTGTAAATTATAGTCGGTTTAGGGTAGAAGCAAA </td></tr> <tr> <td> N2_B8 </td><td> TGTTCCAGCACGACTCCAGCATTAAAAGCCGACTTACAATAAGAGAAT </td></tr> <tr> <td> N2_B9 </td><td> AAGGGCCTTAGAAATGAAACTGGCAACAACTGGCCTCCTTAAGTCAGA </td></tr> <tr> <td> N2_B10 </td><td> TAGAGCTTAAGAGGTCAACCGTAAATTAAACGATTGTTACAAAATAAAC </td></tr> <tr> <td> N2_B11 </td><td> TTAAGAAAGGTAGGTGGTTGATGGGCCAAGCGGTCCACGCTGGTTGGCG </td></tr> <tr> <td> N2_B12 </td><td> ACAAACAAATAAATAGCGTCAAGCCGCCCAGAGTACAATTACTCGCGCA </td></tr> <tr> <td> N2_C1 </td><td> CGGCTACTTTGAGGAAACGGGACGTAATAGGCACCAAACGAAAGAGGCA </td></tr> <tr> <td> N2_C2 </td><td> GCAGGCGTGTACTGTTAACGGGGAACCACCATCTTGTCATAGCCCCCTT </td></tr> <tr> <td> N2_C3 </td><td> GTGTTGTAACAAGAGTCCACTGTGGACTCCAACGTAAAACCGGTTTATC </td></tr> <tr> <td> N2_C4 </td><td> TTTTTTCCCCTCAATCGAATTTAAAGAAGTGAGTGCAGCGTGAGTTGAA </td></tr> <tr> <td> N2_C5 </td><td> GATAAACCGAGAAATAGATATAAAAAAATACATACATAAAGCGTCCTTT </td></tr> <tr> <td> N2_C6 </td><td> TTGTACCTCATACAGTGGCATCAATTCTGTTTAGCAACGCAATTTTAGA </td></tr> <tr> <td> N2_C7 </td><td> CTTCAAAGCGAACCATCGCGTACAAGAGTCAATCAGAATCTTTTGCACC </td></tr> <tr> <td> N2_C8 </td><td> CAGATAGCCGAACAATAGCTAATTGAGTTTTTGCGTTATTTCTATATTT </td></tr> <tr> <td> N2_C9 </td><td> GCCTGGAGAGGGTAAAGGGAATGGATCTGAATCACCCTCAGACGGATAA </td></tr> <tr> <td> N2_C10 </td><td> GGCAATTCAGAGTAGCCTTTCTGATGATTCCAGTACCTCATTGAGGCAG </td></tr> <tr> <td> N2_C11 </td><td> TTAATTTTATTAGGATTAGCGTTTGCCGCGGATCATGAGCTACTTTCCA </td></tr> <tr> <td> N2_C12 </td><td> TGCTTTTACCCGAAAATGGATACATCACCCTGTAATACTAAGCCCGAGA </td></tr> <tr> <td> N2_D1 </td><td> CAGCCAGGCGCAGTGTCACTGCACTCTGGCTGGAGGTGTCCAGGTCATT </td></tr> <tr> <td> N2_D2 </td><td> GCCACGGCCGCCACGCCACCCTCAGAACAGAGCCACACGACGTGGGTAA </td></tr> <tr> <td> N2_D3 </td><td> GTCAATAGACCATTTCATATAAATGCCTACTGAACAGAGAATAACATAA </td></tr> <tr> <td> N2_D4 </td><td> GAAAGCTGAGATGATGAAAAAAAGCTATCCGCATAAAGTGTAAAGCTAA </td></tr> <tr> <td> N2_D5 </td><td> ACGCTGACAAATGAAAGTATCCGACAAATCTAAAGTCACCTTGCTGAAC </td></tr> <tr> <td> N2_D6 </td><td> TGGACGCTCCGGTATGAGCCGGGTCCCGCCGGTGGCTTTAATATAAACA </td></tr> <tr> <td> N2_D7 </td><td> CATTCCAGAACCACCACCAATATACTAGGGTTTGGAACAGCGCGGTTGA </td></tr> <tr> <td> N2_D8 </td><td> GCGGATTCCTGACTACGTTAAAAATTCGTCAACAAAGTCCTGAAGCGGG </td></tr> <tr> <td> N2_D9 </td><td> CAGCTACAAGGAATAGCCCTTTTATCCTTATGTACAATCAGAATTAAGA </td></tr> <tr> <td> N2_D10 </td><td> CGGCGAACATTCGCCACGAGTGTGAGTTCAGGCTGCAACGCGTAAGACA </td></tr> <tr> <td> N2_D11 </td><td> CAGGTCTACGAGAACATTTTTGAACGCCAGAAAAACCCATCCTAGAACC </td></tr> <tr> <td> N2_D12 </td><td> GCAGAAGGGATAGCTCTCAACGTGAGAATCGACAACCCGATAGATATAA </td></tr> <tr> <td> N2_E1 </td><td> AACCGATTGAGGGAGTCGCTACCGTAATAGAATCAGGAACCGAATCACC </td></tr> <tr> <td> N2_E2 </td><td> CTTCTGAATGGTTTCCGTGTGGAGGAAACCGAGGAAACGCAAATACCCA </td></tr> <tr> <td> N2_E3 </td><td> ACTTTCTCCGTGGTGAAACAGCCAGCAGTTGGGCGGTTGTGTGAAAAAG </td></tr> <tr> <td> N2_E4 </td><td> TGGTGCCGCACCGTTGTAGCACTTTGATATCACTTGTAGAAGATCGGCC </td></tr> <tr> <td> N2_E5 </td><td> TCTCGCCCGGATAACCTCCCTACCCTCAGAACCGCTTACCGTACAGGAG </td></tr> <tr> <td> N2_E6 </td><td> TGTCAAGCGCGAAACAAAGGCTGATTCTATACCAGGCCGAGAATGAAAA </td></tr> <tr> <td> N2_E7 </td><td> GGAAATGCTCCTTTTGATAATTGCGCTGTAGTCTGCGATTAGTTTACTT </td></tr> <tr> <td> N2_E8 </td><td> CGCACAGGCGTAGCAGAGGGGCCTTTAGCTTATCCTTATTCCTCAAGAG </td></tr> <tr> <td> N2_E9 </td><td> AATCGGAGGGGTCGAGGTGCCGTAGAACATTAAAAAAAGATAGCCCGGC </td></tr>







<tr><td><br><br><br></td><td><br><br><br></td></tr>


<tr> <td> rot1_unmod </td><td> CATATAAACATCCCTTACAGCCAGTTACCCT </td></tr> <tr> <td> rot2_unmod </td><td> CCACGGTGCCCAGATGCAATTAAGCAAAATCTCAG </td></tr> <tr> <td> rot3_unmod </td><td> AACCGCAAGAATGCGCAACCAACTCAATACTGTTGGCTCGTCAAAGCCT </td></tr> <tr> <td> rot4_unmod </td><td> TCATTTGTGAAAAGGGCAAGGCAAAGAATAAAGCTAAATCGG </td></tr> <tr> <td> rot5_unmod </td><td> GAGTGGGCCTACTAATATAACATCCAATAAAAAAAACATTATGAT </td></tr> <tr> <td> rot6_unmod </td><td> AGTGCTGACCTTCATCAATCTTGATAACAAA </td></tr> <tr> <td> gelb1_unmod </td><td> TCAGATGAGTGCGTGAAATAGCCGCCGCCAG </td></tr> <tr> <td> gelb2_unmod </td><td> AACCCACAACAGTCAAGCGGATCTTACCGAAGCCCAAGTAAG </td></tr> <tr> <td> gelb3_unmod </td><td> ACAGTCAAATAATAACAATGAAATAGCAAAGTTAC </td></tr> <tr> <td> orange1_unmod </td><td> TGACGGAATAACCTTGCTTCTGTAAATCGGGAAGGAATTATC </td></tr> <tr> <td> orange2_unmod </td><td> AGGCATCGATAGGCCGGTTTGTCACATTGAGCCGACAT </td></tr> <tr> <td> orange3_unmod </td><td> CAAGACACGCACATCCTTGAAAACATACAGCGCCTACCAAT </td></tr> <tr> <td> rot1_15A </td><td> CATATAAACATCCCTTACAGCCAGTTACCCTAAAAAAAAAAAAAAA </td></tr> <tr> <td> rot2_15A </td><td> CCACGGTGCCCAGATGCAATTAAGCAAAATCTCAGAAAAAAAAAAAAAAA </td></tr> <tr> <td> rot3_15A </td><td> AACCGCAAGAATGCGCAACCAACTCAATACTGTTGGCTCGTCAAAGCCTAAAAAAAAAAAAAAA </td></tr> <tr> <td> rot4_15A </td><td> TCATTTGTGAAAAGGGCAAGGCAAAGAATAAAGCTAAATCGGAAAAAAAAAAAAAAA </td></tr> <tr> <td> rot5_15A </td><td> GAGTGGGCCTACTAATATAACATCCAATAAAAAAAACATTATGATAAAAAAAAAAAAAAA </td></tr> <tr> <td> rot6_15A </td><td> AGTGCTGACCTTCATCAATCTTGATAACAAAAAAAAAAAAAAAAAA </td></tr> <tr> <td> gelb1_15A </td><td> TCAGATGAGTGCGTGAAATAGCCGCCGCCAGAAAAAAAAAAAAAAA </td></tr> <tr> <td> gelb2_15A </td><td> AACCCACAACAGTCAAGCGGATCTTACCGAAGCCCAAGTAAGAAAAAAAAAAAAAAA </td></tr> <tr> <td> gelb3_15A </td><td> ACAGTCAAATAATAACAATGAAATAGCAAAGTTACAAAAAAAAAAAAAAA </td></tr> <tr> <td> orange1_15A </td><td> TGACGGAATAACCTTGCTTCTGTAAATCGGGAAGGAATTATCAAAAAAAAAAAAAAA </td></tr> <tr> <td> orange2_15A </td><td> AGGCATCGATAGGCCGGTTTGTCACATTGAGCCGACATAAAAAAAAAAAAAAA </td></tr> <tr> <td> orange3_15A </td><td> CAAGACACGCACATCCTTGAAAACATACAGCGCCTACCAATAAAAAAAAAAAAAAA </td></tr>




<tr><td><br><br><br></td><td><br><br><br></td></tr>


<tr> <td> instead of </td><td> N2_C7, N1_D8, N1_B1, N1_G9, N1_G11 </td></tr>


<tr> <td> 76[77] </td><td> CTTCAAAGCGAACCATCGCGTACAAGAGTCAATCAGAATCTTTTGCACCB </td><td> 49 </td><td> #57bb00 </td><td> 3' Biotin </td></tr> <tr> <td> 45[87] </td><td> AATGACAACACGTGGTTCTCACCGGCTTTAGCCACTGCAATAGTAAC </td><td> 47 </td><td> #57bb00 </td></tr> <tr> <td> 75[70] </td><td> TTAGCCTTAGAACCCCTCAAAT </td><td> 22 </td><td> #57bb00 </td></tr> <tr> <td> 74[77] </td><td> CGGTCTGTTATATTTGGCAACAGGAAGATTGTAGTTGCGCGCCTGB </td><td> 45 </td><td> #57bb00 </td><td> 3' Biotin </td></tr> <tr> <td> 72[56] </td><td> CGCCAGGGTGTTAATTTTTTTTCCCAGTCCACCCTGATAGCAB </td><td> 42 </td><td> #57bb00 </td><td> 3' Biotin </td></tr> </table> </td><td> <img src="http://openwetware.org/images/b/b7/Cadnano_Staples.png" width="358" height="1075" > <font size="3 "><div align="center">Figure 1: caDNAno-File of the Nanoscooter.</font></td></tr></table> </td><td></td></tr></table> </body></html>