Berglund:Stratagene Quickchange

From OpenWetWare
Jump to: navigation, search

Quick Change Protocol-mBBP 1-360 fixing a glycine mutation

Forward and Reverse Mutagenic primers:
Both primers should contain the mutations of interest
25-45 bases in length
Tm should be greater than or equal to 78°C
Calculate for these primers with mutations:
Tm=81.5+0.41(%GC) – 675/N (N= # of all bases EXCEPT the mutation bases)
The mutation should be in the middle of the primer with 10-15 bases of correct sequence on either side
Primers should have a GC content of 40% or more and should terminate in one or more C’s or G’s.
Primers must be cleaned using a polyacrylamide gel, otherwise mutation efficiency decreases.
Primer content during PCR must be in high excess of the template (changing template conc may help)

STEP 1: designing the primers
Want to fix the glycine mutation in mBBP 1-360 plasmid in pgex
ATGGCGACCGGAGCGAACGCCACGCCGTTGGACTTCCCAAGTAAGAAGCGGAAGAGGAGCCGCTGGAACC AAGACACAATGGAACAGAAGACAGTGATTCCAGGAATGCCTACAGTTATTCCCCCTGGACTTACTCGAGA ACAAGAAAGAGCTTATATAGTGCAACTGCAGATAGAAGACCTGACTCGTAAACTGCGCACAGGAGACCTG GGCATCCCCCCTAACCCTGAGGACAGGTCCCCTTCCCCTGAGCCCATCTACAATAGCGAGGGGAAGCGGC TTAACACCCGAGAGTTCCGCACCCGCAAAAAGCTGGAAGAGGAGCGGCACAACCTCATCACAGAGATGGT…

W/A= TGG to GCG
GC= 55%
TM=73°C

AemBBP1-360gly F or R
5’ CCAAGTAAGAAGCGGAAGAGGAGCCGCTGGAACCAAGACA Forward
5’ TGTCTTGGTTCCAGCGGCTCCTCTTCCGCTTCTTACTTGG Reverse

STEP 2: PCR with Advantage taq, 16 cycles

PCR reaction
38µl water
5µl thermalace buffer
1µl 50xdNTP
2µl forward 10mM
2µl reverse 10mM
1µl template
1µl advantage taq

program:
95°C 30sec
95°C 30sec, 55°C 1 min, 68°C 6min (16 cycles total)
37°C infinity

STEP 3 Dpn 1 digestion (digestion of methylated DNA)
Add 1µl of Dpn1 enzyme to each reaction.
Mix well
Incubate each reaction for 1 hr at 37°C in the thermocycler with the hot bonnet to digest the template

STEP 4 ethanol ppt, resuspend into 8 µl, ligate overnight

STEP 5: transformation into tg1 cells, use 5µl

STEP 6: sequencing with pGEX3 primers, cut inserts to see if the insert is still the proper size, may need an internal primer