OUR TEAM
LAB 3 WRITE-UP
Original System: PCR Results
PCR Test Results
| Sample Name |
Ave. INTDEN* |
Calculated μg/mL |
Conclusion (pos/neg)
|
| Positive Control (+) |
4438005 |
13.50 |
N/A
|
| Negative Control(-) |
2361911 |
-8.43 |
N/A
|
| Tube Label: A1 Patient ID: 10840 rep 1 |
818350 |
-24.74 |
Neg
|
| Tube Label:A2 Patient ID: 10840 rep 2 |
829045 |
-24.63 |
Neg
|
| Tube Label:A3 Patient ID: 10840 rep 3 |
331978 |
-29.878 |
Neg
|
| Tube Label:B1 Patient ID: 12675 rep 1 |
905925 |
-23.814 |
Neg
|
| Tube Label:B2 Patient ID: 12675 rep 2 |
540926 |
-27.670 |
Neg
|
| Tube Label:B3 Patient ID: 12675 rep 3 |
2729798 |
-4.546 |
Pos
|
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Bayesian Statistics
These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.
Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B)
Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.
- A = frequency of cancer positive conclusions = 9/20= .45 = 45%
- B = frequency of positive PCR reaction = 26/60 = 0.43 = 43%
- P (B|A) = frequency of positive PCR given cancer-positive conclusion = 25/26 = 0.96 = 96%
- P(A|B) = 100= 100%
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
- A = Frequency of mismatch for positive = .35= 35%
- B = Frequency of all mismatches = 9/20 = .45 = 45%
- P (B|A) = Given the patient will develop cancer, what is the probability of a cancer DNA sequence= 6/7 = 0.86 = 86%
- P(A|B) = 67%
New System: Design Strategy
We concluded that a good system Must Have:
In order for the PCR to be efficient when analyzing samples, it needs to have fast imaging results. In practical uses, the PCR will be testing large numbers of samples, where fast imaging would be needed to determine information in limited time. Using this component, it is possible to even run multiple trials to determine the accuracy of the data received. The time saved using this key necessity could then be directed towards utilizing the data to understand relationships between patients. This feature is imperative to allow us to understand the correlation between the samples and the patients on a larger scale.
The sample volume used by the PCR needs to be small, as there is a limited amount of a given sample, with many tests needed to be taken to attain accurate data. This directly correlates to the size of the PCR, where a larger sample size would require a larger machine, which is inefficient. When the initial sample size is minimal, there is still a possibility to run multiple trials without risk of depleting the sample source. This feature is required to suit any given circumstance of initial sample volume, and will allow multiple PCR measurements, regardless of the size.
We concluded that we would Want a good system to have:
If the PCR is portable, this will eliminate the need for samples to be sent to centers that house the device. This will allow scientists to reduce the time wasted for the sample to be sent to these facilities, and data can be collected much earlier. With the device being compact, it will allow for multiple PCR's to be housed in a given area, which will allow a greater quantity of samples to be analyzed simultaneously. While these components would greatly improve the process, they are not the main priority when attempted to analyze samples through the PCR.
With the price of the PCR being relatively low (Open PCR: $600, Fluorimeter: $300), this allows for more widespread use of the machine. This would allow private use of the PCR to the public, making it affordable to accumulate important data. This component would also allow for the purchase of additional PCR machines or other supplemental equipment. This greatly supports the spread of scientific thinking, making it a possibility to use this resource by those lacking numerous funds. While this would be ideal to have for the machine, it is not necessary to have such a low price, as research can still be headed by large institutions or companies.
We concluded that a good system Must Not Have:
- Troublesome USB Connectivity
It is necessary for the PCR to have strong USB connectivity, as it is through this that the images are created and analyzed for data. Problems associated with this connectivity would greatly impair the overall process as well as by effecting the data received from the device. This is one of the most important parts of the PCR, as it allows for the entire image analysis to take place. PCR machines would only be approved for use if this problem did not exist, as it would defeat the purpose of using the machine.
The most important part of any experiment is the safety of the scientist(s) who are involved. Without the temperature of the casing optimized, the machine cannot be safely used to investigate a set of samples. Not only could this lead to possible harm to the scientist and the laboratory, but it could also release chemicals that can release toxins into the surrounding area. Health is a primary concern, and the PCR cannot have this issue for the safety of those utilizing it for scientific purposes.
We concluded that a good system Should Avoid:
As with any scientific process, using a PCR must take into mind the resources expended for samples to be analyzed. In order to have an efficient, affordable collection of data, the power consumption should be limited to avoid unnecessary consumption of resources. This could prove to be a problem when analyzing large quantities of samples with multiple trials, which could greatly tax energy resources. While this is a major problem that cannot be allowed, it would't greatly affect the actual experimental process of the PCR, thus making it something we should avoid.
- Analyzing Individual Samples
In most PCR experimentation there needs to be large quantities of sample analyzed, and this form of data collection would be tedious and take absurd amounts of time. This is highly inefficient when compared with analyzing multiple samples simultaneously, wasting precious time in collecting the necessary data for an experiment. It would be harder to identify an accurate data among a set when each sample is analyzed individually rather than as a whole. While this would greatly slow down the pace of the data, it doesn't disrupt the actual experimentation process or harm the user in any way.
New System: Machine/ Device Engineering
SYSTEM DESIGN
The only thing changed in our design is the type of material used. Our materials will be changed to be cheaper, and to provide for a safer machine.

Photo of the Single-Drop Fluorimeter Device. (Image used from Google Images, http://openwetware.org/wiki/BME103:T130_Group_6)
The Flourimeter device design will be unchanged. It worked well for these particular experiments, and the design does not need to be changed. The purpose of the Fluorimter is to detect certain substances within the DNA, using a fluorescent dye that shows positive for the type of case that is being tested. The device is suposed to be used by putting drops of dye in the tray so that a beam of light shines through. The whole device in a dark box, which shows whether or not the dye is fluorescent. A camera is placed facing the drop, and takes a picture so that the drop can be analyzed using Image J software on the computer.
Error creating thumbnail: File missing
Photo of Open PCR Machine.
The only thing that will be changed in the Open PCR design is the type of materials that will be used. It was found that the results of the lab came back accurate, giving no reason for the design of the machine to be changed. The only changes will be because of safety concerns. The Open PCR Machine has an exterior made of thin plywood, easily able to catch on fire with the high temperatures that it is dealing with. The new design will have an exterior made of metal, making sure that no fire hazards exist. The purpose of the Open PCR machine is to send DNA samples through cycles of heating up and cooling down, priming them to be analyzed by the Fluorimeter device.
KEY FEATURES
We chose to include these new features
- Feature 1 - Heat Resistant Exterior - The heat resistant exterior is a main concern that our group had with the original product. As soon as we realized that the machine would be heating up to temperatures that would easily start the thin plywood on fire, it was obvious that the materials needed to be changed. The new material that we will use will be a thin sheet of metal that is light and has an extremely high melting point. The metal needs to be light so that it can be portable, and the melting point needs to be high so that the temperatures in the system do not melt the machine. The meltal also needs to have low conductivity because the outside of the machine can't be hot while the operator is working with the device.
- Feature 2 - Fast Imaging Results - One of the problems that was found during testing was that the time it took to find the actual values took much longer than it should have. A solution to this problem would be to develop a software that automatically does the calculations that Image J currently does. The reason why this is important s because it would be much faster and much more accurate with a computer making the precise decisions that a human would have to do. The computer would be able to be quick and accurate, making the lab go much smoother and with less error in the results.
STEP-BY-STEP INSTRUCTIONS
1. Synchronize the software to ensure precise accuracy with the Open PCR
2. Place the DNA sample into the slots in the heating lid
3. Press the start button on Open PCR software
4. Let sit for the designatated time
5. Take out the samples
6. Analyze the results using the Single-Drop Fluorimeter Device
New System: Protocols
DESIGN
We chose to include these new features
- We decided that the existing protocol were extremely efficient and should be left as is. The current protocol returned fast imaging results and the preparation did not take up a huge amount of time. Also, the current protocol requires software can be downloaded for free, which reduces the cost of the system. The only slight change, or improvement we'd make would be to improve the USB connectivity. The current connectivity could pose problems which will lead to inaccurate data and furthermore an inaccurate positive or negative.
MATERIALS
| Supplied in the Kit
|
Reaction Mix (MgCl2, dNTP's,Taq DNA polymerase)
|
| Software
|
| Supplied by User
|
| Camera
|
| SYBR-Green I
|
| DNA sample
|
Primer mix (forward & reverse primer)
|
PROTOCOLS
- Before preparing the samples, the software to run the Polymerase Chain Reaction (PCR) machine needs to be downloaded from the website.
- First, use a micropipette to transfer 50 μL of the given PCR reaction mix into the corresponding tube.
- Then, transfer 50 μL of the DNA/ primer mix to the corresponding tube. If more than one sample is being tested then the tubes must be carefully labeled.
- After the samples are mixed, the tubes need to be placed into the Polymerase Chain Reaction (PCR) Machine. Open up the software and program the cycle to run for the appropriate time, outlined below.
Thermal Cycler Program
Heated Lid: 110°C
Initial Step: temp: 95°C time: 180 sec
Number of Cycles: 35
Denaturing: temp: 95°C time: 30 sec
Annealing: temp: 57°C time: 30 sec
Extending: temp: 72°C time: 30 sec
Final Hold: temp: 4°C
- DNA Measurement and Analysis Protocol
- To begin the DNA measurement and analysis, you have to calibrate the machine with the negative sample.
- First you step up the single drop fluorimeter and set up your phone with the correct settings. Then using a micropipette, place 80 µL of the SYBR I green onto the hydrophobic tray. Following the SYBR I green place 80 µL of the DNA mix sample. Then turn on the light and prepare to take a picture of the droplet under the box, cutting out as much light as possible.
- The next steps involve the use of Image J that can be downloaded from the internet for free. Upload the picture taken and from the image tab select color then split channels but exit out of all images except the green one. Using the oval tool select an area within the drop. Once the area is selected, click on the analyze tab and then measure and then a window will pop up that will have the area and INTDEN values.
- The steps outlined above will be repeated for each sample and if one sample has more than one trials the average of the INTDEN values needs to be calculated and that's what will be used. Furthermore, the area of the droplet used in Image J needs to remain constant throughout all trials.
New System: Research and Development
BACKGROUND
CHEK2 gene stands for Checkpoint Kinase 2 and is plays a role in cancer. This gene is a protein kinase. A protein kinase is involved in the phosphorylation of proteins. In other words, they add phosphate groups to proteins in order to regulate cellular pathways. The CHEK2 gene specifically is associated with DNA repair. When DNA is damaged, the CHEK2 gene is triggered. The protein that this gene encodes is involved in tumor suppression. Thus, when a damaged, the protein begins to phosphorylate in a way that prevents the occurrence of mitosis. Thus, the damaged DNA is not replicated. However, a mutation or polymorphism of the CHEK2 gene results in the improper prevention of DNA replication. This is because, without this gene, the damaged DNA-containing cells do not undergo apoptosis, or programmed cell death. Thus, the mutated DNA is replicated, causing an increase in susceptibility of cancer. An SNP, or single nucleotide polymorphism, occurs when a single nucleotide in a gene is changed, resulting in a change in sequence of the replicated DNA. An example of this can be seen in CHEK2. Take for instance the normal allele ATT. An polymorphism of this allele is ACT. This SNP causes a change in the complementary DNA strand. Instead of having an allele of TAA, the complementary strand would have TGA instead. This small mutation in DNA if, amplified repeatedly in the body, can result in cancer.
DESIGN
Primers for PCR
This new system for Polymerase Chain Reaction, PCR, will amplify the cancer-associated DNA in order to more easily observe the presence of cancer in a patient. The primers for this will focus on the ATT-ACT mutation, amplifying the sequence with the single nucleotide polymorphism. The cancer allele forward primer will be: [TTGAGAATGTCACGTATGTAT]. Notice that the mutation is in bold. Similarly, the cancer allele reverse primer will be [AACTCTTACAGTGCATACATA]. The mutation in the complementary strand is indicated in bold as well. Due to the fact that these primers are designed to bind to DNA strands with the cancer mutation, a product will only form if the patient has the disease. For example, the normal allele, ATT, will not bind to the reverse primer because its complement is TAA, while this primer's is AGT. Primer annealing only occurs in accordance to the complementary base pairing rules of DNA.
Our primers address the following design needs
- These primers bind to the cancer gene, amplifying a mutated sequence. Due to this, the presence of cancer is easy to detect, increasing the efficiency of the PCR process. What is more, this results in more precise results, because annealing will only occur if cancer is present. The fact that the material used to make this new PCR is more durable in the face of high temperatures, the primes will also have a more stable environment to function in, lowering the risk of burning and improper binding.
|