BME103:T930 Group 3

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Error creating thumbnail: Unable to save thumbnail to destination Rohan Kumar Experimental Protocol Planner Error creating thumbnail: Unable to save thumbnail to destination Kyle Stoneking Experimental Protocol Planner Error creating thumbnail: Unable to save thumbnail to destination Lekha Anantuni R&D Scientist Error creating thumbnail: Unable to save thumbnail to destination Joshua Eger Machine Engineer Error creating thumbnail: Unable to save thumbnail to destination Austin Cuaderno Machine Engineer LAB 1 WRITE-UP Initial Machine Testing The Original Design The OpenPCR is a machine that is used to replicate DNA in order to amplify a specific gene. This machine primarily uses changes in temperature and various enzymes to facilitate the replication process multiple times. If the heating lid did not work, then DNA replication would not be possible. The heating lid covers the thermal cycler and holds the DNA down tight and fluctuates in temperature. The thermal cycler is where the samples are place and varies at set temperatures and times. The temperature change is crucial to the replication of DNA because only at certain temperatures dose the DNA properly replicate. The LCD display outputs the temperature of the thermal cycler. The power supply connects to an external power source. Experimenting With the Connections When we unplugged the LCD display wire(part 3) from the Arudnio chip(part 6), the screen turned off. Everything on the PCR was working fine expect there was no output on the display. When we unplugged the white wire that connects Arudino chip(part 6) to thermal cycler (part 2), the reading from the screen dropped to -40 degrees Celsius. We disconnected the wire multiple times and each time the screen displayed -40 degrees Celsius. Test Run We ran a test run on 10/25/2012. For this test we placed some empty PCR tubes into the machine and ran a simple test program on the Open PCR software. After the simple test was over we noticed that the display screen on the Open PCR lid matched very closely with what was displayed on our computer screen. The agreement between our computer screen and our PCR display meant that our diagnostic test was a success. Protocols Polymerase Chain Reaction We have been given 3 sets of samples of replicate DNA from two patients, to test for cancer makers. We labeled each sample carefully as to not cross contaminate the samples. We also used one positive control sample and one negative control, which contained no DNA,to give us a total of 8 samples. We mixed the samples together with Taq DNA polymerase, MgCl2, dNTP'S, forward primer and reverse primer. We used the PCR machine to replicate the DNA. After the PCR had finished replication, drops of the samples, mixed with syber green, were then placed in a fluorimeter. We used a Samsung Galaxy Nexus smartphone to take pictures of each drop. We then used image j to analyze the drops. Polymerase Chain Reaction Procedure: 1.)We received 3 replicate DNA samples each from two patients and One positive control and negative control sample for a total of 8 samples. The samples we were given were already in their PCR reaction mix form. This mix contained Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. Each sample was 50 micro liters. 2.)We labeled 8 empty PCR tubes. For the first sample we labeled the 3 DNA samples 1A, 1B and 1C. For the second sample we labeled the tubes 2A, 2B and 2C. For the positive and negative controls, we labeled the tubes + and - respectively. 3.)Using one pipette per sample, to avoid contamination, we transferred the PCR reaction mix we were given to the PCR tubes. 4.)We then placed the samples in the PCR machine 5.)We set our PCR program to three stages. Stage one: 1 cycle, 95 degree Celsius for 3 minutes. Stage 2: 35 cycles, 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, 72 degrees Celsius. Stage three: 72 degrees Celsius for 3 minutes and then hold at 4 degree Celsius. The Patient Information Patient Identification Number Gender Age 43891 Male 48 36890 Female 56 GO Taq DNA Mix Reagent Volume Template DNA (20 ng) 0.2 μL 10 μM forward primer 1.0 μL 10 μM reverse primer 1.0 μL GoTaq master mix 50.0 μL dH2O 47.8 μL Total Volume 100.0 μL Fluorimeter Assembly Error creating thumbnail: Unable to save thumbnail to destination Error creating thumbnail: Unable to save thumbnail to destination Error creating thumbnail: Unable to save thumbnail to destination Error creating thumbnail: Unable to save thumbnail to destination 1.) The first picture is the extertor of the fuorimeter. 2.) The second picture shows the interior. The smartphone camera is angled to have a view of the slide. During actual use the slide platform was sightly elevated with plates for a better view of the drop. 3.) The third picture shows the slide in view of the camera. During actual use the settings were changed and the lid was closed for optimal accuracy. 4.) The fourth picture is an areial view of the what the slide setup looks like. The water drop is nested in place. Fluorimeter Procedure: 1.) Using permanent marker we numbered the transfer pipette at the bulb, so its only used for one sample 2.)With the permanent marker we also labeled the Eppendrof tubes at the top, we had a total of 10 Eppendrof tubes labeled and 10 pipettes labeled. 3.)We transferred each sample separately into the Eppendorf tubes containing 400 ml of buffer. 4.)Using a specially labeled Eppendorf tube containing SYBR GREEN, with its own pippter, we placed two drops onto the first two center drops. 5.)Then using the sample we placed two drops on top of the SYBR GREEN solution drops 6.)Then we aligned the blue light to pass through the drop. 7.)Then the smartphone operator took a picture with the settings on the phone adjusted to inactive flash, iso to 800, white balance to auto, exposure to the highest setting and contrast to the lowest setting. 8.)This process was repeated for all samples 9.)After picture was taken it was given to the Image J software Error creating thumbnail: Unable to save thumbnail to destination Error creating thumbnail: Unable to save thumbnail to destination 1.) The first image is the positive control sample before ImageJ analysis. 2.) The second image is the negative control sample before ImageJ analysis. Image J Procedure: 1.) Using the menu selection we used, analyze> set measurements and chose area integrated density and mean grey value 2.) Using the menu selection we used, image > color > split channels 3.) This created 3 files: a red, green and blue image. We only used the green image. 4.) Then we clicked the menu bar to activate the oval selection. 5.) We drew an oval around the image of our sample and then selected analyze > measure. 6.) We then simply moved the previously drawn oval to an area away from the sample to obtain the noise measurements. 7.) We repeated this process for all of the samples, including the controls. Research and Development Specific Cancer Marker Detection - The Underlying Technology In order to isolate and detect the cancer-causing gene, we essentially added a very specific primer that attaches to the cancer gene on the DNA. This Primer will not only allow for replication of the DNA, but more specifically, replication of the cancer gene in the DNA sample. The Open PCR machine then manipulates the temperature of the sample to facilitate the constant replication of the isolated DNA strands. We cycled the machine 30 times (the DNA was replicated 30 times) to be sure we had enough of the cancer DNA present in our solution. By understanding the mechanism of the Open PCR, we can intuitively understand how genes with specific diseases - such as cancer - are amplified. It is now necessary to learn how to identify which samples contain those replicated genes. The rs17879961 cancer-associated sequence in particular, can be identified within the DNA because of the single nucleotide variation - in this case a missense mutation - in its gene code. The mutation will yield a positive identification marker for cancer when the nucleotide cytosine is replaced by thymine in a very specific section of the DNA. Original Code: GGAAGTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC Code with SNP: GGAAGTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC Our research of the DNA sequence rs17879961 reveals that the gene sequence is correlated most directly to Breast and Colorectal Cancer. The Protocol section explains how the Open PCR amplifies this specific DNA sequence. A non-cancer DNA sequence would not produce a signal because the primer would not bind to the DNA and therefore would not allow for any replication. Only when we have the specific missense mutation can we replicate the cancer gene and identify a positive signal from the DNA. Although we determined that the DNA sequence rs17879961 was correlated to the Breast and Colorectal cancer, we must look at Baye's rule and other statistics to understand the likelihood that the gene will in fact lead to the development and spread of the cancer. Bayesian reasoning accounts for the prevalence, sensitivity, specificity and false positive rates of a disease in order to further understand that disease. Sensitivity is the likelihood that a person afflicted with the disease will test positive for it, while specificity is the likelihood that a person without the disease will test negative for it. Conditional probabilities of a sample of 180 people in Finland determined that the frequency of this cancer found in Finland was 7.8%. The genotype of this single nucleotide polymorphism change from cytosine to thymine in this population was 1.1% and the genotype without the SNP was found to be 98.9%. For more infomation, visit http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17879961. BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images. Error creating thumbnail: Unable to save thumbnail to destination Error creating thumbnail: Unable to save thumbnail to destination 1.) Both of the above images: http://users.ugent.be/~avierstr/principles/pcr.html Results Sample Integrated Density DNA μg/mL Conclusion PCR: Negative Control 4528827 1.08 Positive PCR: Positive Control (Calf Thymus) 8351858 2 Positive PCR: Patient 1 ID 43891, rep 1 5283304 1.26 Positive PCR: Patient 1 ID 43891, rep 2 4376083 1.05 Positive(borderline) PCR: Patient 1 ID 43891, rep 3 8144751 1.95 Positive PCR: Patient 2 ID 36890, rep 1 4190775 1 Negative(borderline) PCR: Patient 2 ID 36890, rep 2 5721560 1.37 Positive PCR: Patient 2 ID 36890, rep 3 5611447 1.34 Positive KEY Sample = Sample is the DNA sample we are analyzing Integrated Density = The integrated density is similar to a numerical representation of the measure light in a given area. The integrated density in the above table is found by taking the integrated density of the sample and subtracting the background noise from that DNA μg/mL = 2 * ( integrated density of sample / integrated density of positive control(calf thymus)) Conclusion = If the DNA μg/mL is greater than 1 than the sample has indeed replicated. If the sample is less than 1 than it has not shown exponential replication.