BME103:T930 Group 13

From OpenWetWare
Jump to navigationJump to search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

THE A TEAM

Error creating thumbnail: File missing
Name: Marcus Sansoni
Open PCR Machine Engineer
Error creating thumbnail: File missing
Name: Pete Marple
Experimental Protocol Planner
Error creating thumbnail: File missing
Name: Michelle Lipowicz
Experimental Protocol Planner
Error creating thumbnail: File missing
Name: Allen Janis
R&D Scientist
Error creating thumbnail: File missing
Name: Ian Bainbridge
R&D Scientist
Error creating thumbnail: File missing
Name: Tyler Barnes
Open PCR Machine Engineer

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design

https://myasucourses.asu.edu/courses/1/2012Fall-T-BME103-86053-86055-86054/groups/_185919_1//_7761026_1/NEW.jpg
The original machine design from the OpenPCR design team. Used as an affordable tool to amplify a DNA sequence using Polymerase Chain Reaction. You can find information on the OpenPCR device here.


Experimenting With the Connections

To test the machine and it's connectivity several simple tests were run. First we unplugged the LCD display from the CPU, which caused the LCD display to lose power. We also unplugged the connection between the circuit board and the main heating block. After this connection was severed the LCD displayed a reading of -40 °C.


Test Run
October 25, 2012: We used machine number 11 to perform our PCR. The OpenPCR machines in the class showed lots of variation in overall run times, with our machine running on the slower side of the class average. We assume this reflected the individual machine's ability to transition between temperature cycles. The OpenPCR did finish the cycling and based on the second part of our experiment it successfully amplified our DNA sequence.




Protocols


Polymerase Chain Reaction


How it Works
In order to analyze genomes and genes,scientists have used polymerase chain reaction (PCR) techniques to amplify DNA. Multiple copies of DNA sequences much be made to be able to better view specific aspects of a gene due to the fact that isolated DNA samples are too small to view individually. In a test tube, PCR takes place by copying short fragments of DNA over and over again, also known as amplification. By altering the temperature within the test tubes, this allows the DNA strands to separate (boiling), bind to primers (cooled),and catalyze (warmed) to double the amount of DNA fragments after each cycle. By repeating each cycle the amount to DNA grows exponentially as two copies are made per strand.


How to Amplify a Patient's DNA
Step 1- After the Patients DNA is placed in to the test tubes along with the Master Mix, the tubes are placed into the PCR machine.
Step 2- As the machine warms to almost a boil, at 95°C, the DNA strands will begin to separate.
Step 3- Once the PCR machine has cooled down to 57°C, the primer will bind to the target sequence.
Step 4- The PCR machine needs to then warm back up to 72°C in order for extension of DNA to occur. This initiates the taq function where the taq protein, along with magnesium chloride, takes free floating nucleotides (DNTPs) and attaches them to the DNA stand in a reverse direction.
Step 5- Once steps 2-4 are repeated several times, each cycle will create newly replicated DNA stands and allow replication to continue until Master Mix is used up.


PCR Master Mix Components
For a 50µl reaction volume:
-GoTaq® Colorless Master Mix: 25µl
-Upstream primer: 10µM
-Downstream primer: 10µM
-DNA template 1–5µl
-Nuclease-Free Water to 50µl



Substances in Test Tubes

Reagent Volume
Template DNA (20 ng) .2 μL
10 μM forward primer 1.0 μL
10 μM reverse primer 1.0 μL
GoTaq master mix 50.0 μL
dH20 47.8 μL
Total Volume 100.0 μL



Patient Numbers
Patient #29341 is female at the age of 53.
Patient #23292 is male at the age of 56.



Flourimeter


Flourimeter Setup

Error creating thumbnail: File missing



Flourmeter Assembly Procedure
Step 1- Unclasp the black box and place it upside down to make a shade
Step 2- Place the assembly that is holding the slide inside the box
Step 3- Use the pipette to place a little over 2 drops of sample on the slide
Step 4- Turn on the blue light
Step 5- Position the slide so that the light goes directly through the drop
Step 6- Place a smartphone in the stand and position it so that the drop is in the picture



Saving Images to ImageJ
Step 1- Send the pictures from the phone to the email (make sure to keep track of which picture goes to which sample)
Step 2- Open our email on the computer and download the attached pictures on to the computer's picture file
Step 3- Open the ImageJ
Step 4- Click file and then click open (and the files from your computer open up)
Step 5- Click the desired picture and it will open up on ImageJ

Research and Development

Specific Cancer Marker Detection - The Underlying Technology

Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine and cycled through 3 stages. The first stage is done at 95°C, in this stage the DNA double helix denatures into individual single strands. The second stage is dropped to 57°C where the primers anneal to the single strand of DNA in preparation for replication. The third and final stage reheats the sample to 72°C where TAQ polymerase copies all the DNA.

The success of reaction depends on whether or not the primers placed in the mixture match some segment on the DNA strand. In this case the primers match with the known r17879961 (CHEK2) cancer-related segment were placed into mixture with the DNA. Specifically the forward primer is: 3' TGGTATAAGACATTCCTGTC 5' and the reverse primer is: 5' AACTCTTACACTGCATACAT 3'. The reverse primer contains the specific SNP for this gene and the forward primer is 200 bp left of the reverse primer. The specific change in these primers occurs with the change from the typical CHEK2 gene at the 8,511,656 base pair (the 11th nucleotide in the reverse primer) where a thymine is replaced by a cytosine.
Therefore only DNA segments that match these primers will be amplified.

This method of replicating DNA works by having the two primers anneal to different strands of DNA and replicating in one direction. This process leaves two partial strands of DNA which is not the target sequence, however, it does contain the target sequence. Over the next few cycles the other primer will anneal to the same strand of DNA (if the forward annealed to it first then the reverse will anneal to it and vice versa). After annealing it will copy in the other direction and end where the other primer started giving you the 200 base pair target sequence. Because only segments with the primers are amplified if the patient does not have this r17879961 single nucleotide polymorphism (SNP) the DNA will not be amplified. Therefore the positive result for having the r17879961 SNP is the presence of amplified DNA in the PCR reaction. A positive result was detected by using an image of the DNA dyed with Sybr green dye taken in a a black box. The concentration of DNA could be detected by measuring the amount of fluorescence in the picture.


Bayes Rule

The Bayes rule is: p(C/T)= [p(T/C)*p(C)]/[{p(T/C)*p(C)}+{p(T/~C)*p(~C)}]
In the specific case of these patients, 1.1% of of the population of 180 suffered from the C/T mutation leaving 98.9% with the normal gene. This mutation shows a significant link to breast and colorectal cancer as well as a susceptibility for Li-Fraumeni syndrome. A study conducted in Finland found that this mutation occurred in 7.8% the population suffering from caner and only 5.3% of people not suffering from caner.

<http://openwetware.org/images/1/1f/Acetic_acid_db.jpeg>


Image credit to www.nature.com

Pray, Leslie A., Ph.D. "The Biotechnology Revolution: PCR and the Use of Reverse Transcriptase to Clone Expressed Genes." Nature.com. Nature Publishing Group, 2008. Web. 15 Nov. 2012.

Results

DNA Sample Preparation - Step 1
This table describes the procedural steps taken to prepare our samples for the fluorimeter.

Description Eppendorf Tube Label Pipette Label
Patient 1-Sample 1 1-1 2
Patient 1-Sample 2 1-2 3
Patient 1-Sample 3 1-3 4
Negative Control -C 1
Positive Control +C 5
Patient 2-Sample 1 2-1 6
Patient 2-Sample 2 2-2 7
Patient 2-Sample 3 2-3 8
Red Red Dot Red


Fluorimeter Procedure/Results - Step 2
This table correlates with DNA Sample Preparation table and shows how the patient's samples were testing using the fluorimeter.

Image Number Drop 1 Drop 2 Comments
210 SYBRGreen -Control Nothing Noticeable
211 SYBRGreen 2-1 Nothing Noticeable
212 SYBRGreen 2-2 Nothing Noticeable
213 SYBRGreen 2-3 Nothing Noticeable
214 SYBRGreen +Control Very Green
215 SYBRGreen 1-1 Nothing Noticeable
216 SYBRGreen 1-2 Nothing Noticeable
217 SYBRGreen 1-3 Nothing Noticeable
218 SYBRGreen Red Very Green


ImageJ Processing Results - Step 3
This is the raw data from taken from the photos using the ImageJ software.

Sample Area Mean Pixel Value
INTDEN
RAWINTDEN INTDEN
Patient 1-Sample 1 21392 108.197 2314551 2314551
Patient 1-Sample 2 32248 111.873 3607696 3607696
Patient 1-Sample 3 35600 101.153 3601038 3601038
Negative Control 22928 150.115 3441833 3441833
Positive Control 38596 219.663 8478127 8478127
Patient 2-Sample 1 19316 104.921 2026652 2026652
Patient 2-Sample 2 29968 133.532 4001694 4001694
Patient 2-Sample 3 29556 146.149 4319570 4319570
Red 51028 235.047 11993985 11993985
Error creating thumbnail: File missing
Sample Image of Water
Error creating thumbnail: File missing
Sample Image of Calf Thymus DNA


Final Results

Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control 3367501 0 Negative
PCR: Positive Control 8381066 1.193299682 Positive
PCR: Patient 1 ID #####, rep 1 2222463 -0.266289229 Negative
PCR: Patient 1 ID #####, rep 2 3515595 0.040183055 Negative
PCR: Patient 1 ID #####, rep 3 3523638 0.042089246 Negative
PCR: Patient 2 ID #####, rep 1 1944235 -0.3322296265 Negative
PCR: Patient 2 ID #####, rep 2 3891599 0.129296003 Negative
PCR: Patient 2 ID #####, rep 3 4210772 0.204940004 Negative


KEY

  • Sample = is the specfic amount of DNA from the population, which is a cancer patient.
  • Integrated Density = is the total of the gray values of each pixel in a determined area.
  • DNA μg/mL = was found by using the negative and positive controls to create a curve in which each of the integrated density values could be substituted for the x value in the curve equation.
  • Conclusion = tells us if the patient is positive or negative for the cancer gene.