BME103:T930 Group 12 l2

From OpenWetWare
Jump to navigationJump to search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Divya Amrelia
PCR engineer
Name: David Tze
PCR engineer
Name: Nathan Moore
Protocol Planner
Name: Philip Remick
Protocol Planner
Name: Ryan Magnuson
R&D Scientist

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.<

System Design

The picture above is of the original 4x4 PCR Tube Block which we are redesigning. The purpose of the PCR Tube Block is to hold the samples of DNA. In our redesign of the PCR Block, we are manipulating the sample size to a 3x7 block, making it capable of holding 21 DNA sample spaces instead of the generic 16. One of the 21 sample spaces will contain a platinum temperature sensor.


Key Features
PCR Tube Block.:
Our lab group is targeting the process time of the Open PCR; we want to make it quicker and more efficient. In the new design, the PCR Tube Block has been expanded to 21 spaces to encompass more DNA samples. As samples of DNA are usually done in pairs, the last space will be used to insert a platinum temperature sensor, one of the most accurate sensors. This new placement will develop more accurate readings as the position is identical to what we are measuring: the DNA samples. The accurate temperature readings, along with the increase in sample size, will make the Open PCR more efficient as it minimizes the chance of overheating or over-cooling. This prevention saves wasted time created by inaccurate readings. Another change we are making to shorten the process time is shortening the number of base pairs to 150. This difference will cut twenty seconds off the process of each sample and shorten the initial melting point from three minutes to one.


Instructions
The assembly instructions will not change too drastically. First, a new heating lid must be made to fit the size of the new PCR Tube Block. The space containing the current PCR Tube Block would also need to be enlarged. As a result, the modified Open PCR will be slightly larger. After all the parts are readjusted to fit the new PCR Tube Block, insert a platinum temperature sensor into a sample space. Once this is complete, follow the original assembly instructions as they will be identical.




Protocols

Materials

Supplied in the Kit Amount
Micro-pipetter 1
Pipetter tips Set of 40
Labeled Test Tubes Set of 8
Better Software 1 Disk
Primer Mix 3 Sets
PCR Machine 1
Fluorimeter 1
Phone Holder 1
Tris Buffer (SYBR Green 0.025%) Enough for samples
GoTaq® Colorless Master Mix 1
Black Box 1


Supplied by User Amount
Lab Coat 1
Sterile gloves 1
Goggles One Pair
Test Samples Varies
Smartphone 1
Computer 1
ImageJ Software 1
Distilled Water 100mL


PCR Protocol

1. Using the micro-pipetter, transfer primer mix into 8 labeled sample tubes

2. Transfer samples to assign tubes, ensure tips are replaced for each sample

3. Place samples in PCR Machine

4. Run machine to the following setting:

  • Stage One: 1 cycle, 95 degrees Celsius, for 1 minute
  • Stage Two: 35 cycles, 95 degrees for 10 seconds, 57 degrees for 10 seconds, 72 degrees for 10 seconds.
  • Final Hold: 4 Degrees Celsius

DNA Measurement Protocol

The steps for setting up the samples:
1. Open the lid of the PCR machine, and remove the 21 samples from the PCR tray.

2. With the fine point Sharpie, label the transfer pipettes and Eppendorf tubes accordingly to prevent contamination.

3. Measure 400mL of Tris buffer into a 500mL graduated cylinder and pour into each of the Eppendorf tubes.

4. Extract each sample with one pipette (use a new one for each sample to prevent contamination) into an Eppendorf tube that contains 400mL of Tris buffer. Be sure to transfer all of the samples into the tubes.

5. Label the Eppendorf tube with the sample number.

6. Set up the sample DNA calf thymus by pipetting 100μL into an Eppendorf tube containing 400mL of Tris buffer.

7. Pipette 100μL of distilled water into the corresponding Eppendorf tube containing 400mL of Tris buffer.

8. Add the SYBR Green to the Eppendorf tubes with separate pipettes.

9. Open up the fluorimeter box and remove the contents.

10. Disassemble the box by unsnapping it.

11. Put the cover of the box on the bottom facing upside down.

12. Next, place the fluorimeter on top of the box cover.

13. Then, carefully add the glass slide in between the fluorimeter.

14. Use the pipet and remove about .25ml of the sample or water.

15. Place a few drops from the samples prepared in steps 1-8 in the middle of the slots until they conjoin.

16. Turn on the LED light.

17. Make sure the LED is going through the center of the drops, a cone of light should go around it, however, not at an angle.

Steps to setting up camera phone:
18. Carefully place the cell phone stand in front of the fluorimeter.

19. Configure the cell phone by going to the camera menu and doing the following:

  • Inactivate the flash
  • Set ISO to 800 (or higher)
  • Set white balance to auto
  • Set exposure to highest setting
  • Set saturation to the highest setting
  • Set contrast to the lowest setting
  • Set the timer for five seconds

20. Place the cell phone on the stand and take the picture while placing the cover over the fluorimeter.

21. Repeat steps 5-12 as necessary.

The Steps for Image J:
22. Download the Image J software.

23. Save the pictures to smart phone.

24. Be sure to name the pictures in the correct order taken in order to separate the images.

25. Download the pictures onto a computer that has Image J through a USB device or uploading them.

26. Open them with Image J by going to add image. Find image on the files.

Edit the picture:
27. Use the menu selection analyze>set measurements and choose 'area integrated density' and 'mean grey value'.

28. Use the green image.

29. Click on the menu bar to activate the oval selection.

30. Draw the best oval around your green drop image and then select 'analyze>measure'.

31. Write down the sample number and numbers measured.

32. Draw another oval for the of the same size in the green file for the background about the drop to get the "noise". Select 'analyze>measure'. Write drown the sample number and the numbers measure and label this as background. Save your measurements.

Research and Development

Background on Disease Markers
We decided to research and to design primers that will help detect a specific SNP that causes Alzheimer’s disease. Alzheimer’s disease is a form of dementia that affects one in eight older Americans and is the sixth-leading cause of death in the United States (http://www.alz.org/alzheimers_disease_facts_and_figures.asp). It is usually present in people of 65 years of age and older, and causes cognitive deterioration ranging in severity and rate. The average person diagnosed with Alzheimer’s disease lives around 8 to 12 years after diagnoses (http://www.agingcare.com/Answers/How-long-does-Alzheimer-s-disease-last-on-average-133298.htm).

One of the SNP’s (single nucleotide polymorphism) associated with Alzheimer’s is Rs4934, located in chromosome 14, at position # 95,080,803. This missense mutation causes an allele change of GCT ⇒ ACT and is associated with the gene SERPINA3. People with this mutation have a 2.5x increased risk of Alzheimer’s and decreased age at onset (http://www.snpedia.com/index.php/Rs4934(A;A). There was no information pertaining to Rs4934 present in the OMIM database.

DNA Sequence:
• 5'GAATGGAGAGAATGTTACCTCTCCTG[A/G]CTCTGGGGCTCTTGGCGGCTGGGTT3’
• 3’CTTACCTCTCTTACAATGGAGAGGAC[T/C]GAGACCCCGAGAACCGCCGACCCAA5’



Primer Design

• Forward Primer:
• 3’TGGAGAGGACCGAGACCCCG5’

• Reverse Primer (150 basepairs to the left)
• 5’TGAGGGAGGCTCCAAAGCTA3’

The specific disease allele for Rs4934 will give a positive result and a non-disease will not because, the forward and reverse primers were designed to only attach to DNA strands with the GCT ⇒ ACT mutation at position # 95,080,803. Exponential replication will only occur in the strands of which the primers bind to. Because the non-disease allele strands will have a mismatching nucleotide with the primers,(a G instead of C at position # 95,080,803), the primers will not bind to them, making exponential replication impossible.



Illustration

illustration
Click on image for enlarged view.