BME103:T130 Group 4 l2

From OpenWetWare
Jump to navigationJump to search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Error creating thumbnail: File missing
Candice Chen:
Experimental Protocol Planner
Error creating thumbnail: File missing
Brent Hayes Russon:
Research and Development Specialist
Error creating thumbnail: File missing
Abdulaziz Alamal:
Open PCR Machine Engineer
Error creating thumbnail: File missing
Andrew Munoz:
Experimental Protocol Planner
Error creating thumbnail: File missing
Abdullah Alqahtani:
Open PCR Machine Engineer

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design
Error creating thumbnail: File missing

Error creating thumbnail: File missing

Error creating thumbnail: File missing

Key Features

  • One of the inconveniences of the original design is the limited number of samples it can accommodate. We would expand the plate to 6x6 instead of 4x4, more than doubling the original capacity without significantly affecting the machine's dimensions.
  • Another common complaint is the difficulty of seeing how much the lid is screwed down. This is problematic because the lid can't be screwed down too tightly in case it melts the PCR tubes, but it also can't be too loose or else the reaction might not happen properly. We would change the sides of the lid to a clear, heat-resistant plastic so the user can see exactly how much the lid is screwed down.
  • The original PCR machine needs to be plugged into an external power source, so we decided it would be helpful to build a backup battery into the system so the PRC machine can continue running even if there's a power outage. Obtaining and preparing the materials for PCR takes time and money, and it would be unfortunate for the user if that all went to waste because of a power loss. Having a backup battery ensures that the reaction will be able to finish, saving the user from having to redo it if there's an unexpected power outage.


Instructions

  • The modifications to the plate and lid won't change the assembly process, so the original instructions regarding those parts are still valid.
  • The backup battery will need to be connected to the terminal inside the machine and to a new piece we will provide called an inverter. The necessary wires will already be attached to the battery.
  1. Loosen the necessary terminal screw with a 2 mm screwdriver and connect the blue wire. Hold the wire in place while you tighten the screw and pull gently on it afterwards to make sure it is properly connected.
  2. Repeat the process with the green wire to connect the battery to the inverter.


Protocols

Materials

Supplied in the Kit Amount
PCR machine (thermocycler) 1 unit
Instruction manual 1 book
Backup battery 1 unit
Extra screws/nuts/bolts 5 of each
USB cable 1 unit
Power cord 1 unit


Supplied by User Amount
Micropipette 1 unit
Micropipette tips 2 needed for each DNA sample
DNA samples Up to 36 tubes of 50 μL
GoTaq master mix 50 μL needed for each DNA sample
PCR tubes As many as needed for all DNA samples
Computer installed w/OpenPCR & ImageJ software 1 unit
Transfer pipettes As many as needed for all DNA samples + 4
Eppendorf tubes As many as needed for all DNA samples
Eppendorf tube rack 1 unit
Fluorimeter 1 unit
Superhydrophobic glass slides As many as needed for all DNA samples
SYBR Green I 5 mL
Calf thymus (2 μg/mL) 50 μL
Distilled water 5 mL
Smartphone w/camera 1 unit
Smartphone cradle 1 unit
Light box 1 unit


PCR Protocol

  1. Use the micropipette to transfer each 50 μL DNA sample into its own labeled PCR tube. Be sure to use a separate micropipette tip for each sample to avoid cross-contamination.
  2. Use one of the transfer pipettes to add 50 μL of GoTaq master mix to each PCR tube. Make sure the tip of the pipette doesn't come in contact with any of the DNA samples to avoid cross-contamination. Discard the pipette once the master mix has been added to each tube.
  3. Plug the PCR machine into a power source and turn it on. Use the USB cable to connect the PCR machine to your computer and open up the OpenPCR program.
  4. Click "Add a new experiment" and then the "More options" button at the bottom and enter the following settings:
    • Heated Lid at 100°C
    • Initial Step at 95°C for 180 seconds
    • 35 cycles with Denaturing at 95°C for 30 seconds, Annealing at 57°C for 30 seconds, and Extending at 72°C for 30 seconds
    • Final Step at 72°C for 180 seconds
    • Final Hold at 4°C
  5. Name the program as desired and save it.
  6. Open the lid of the machine and place the PCR tubes inside. When you screw the lid back down, check to make sure it is touching the tops of the tubes but not pressing down too hard on them.
  7. Click "Start" in the OpenPCR program and allow the machine to run.


DNA Measurement Protocol

  1. When the PCR program is finished, remove the PCR tubes from the machine and place them in the tube rack. Use the micropipette to transfer each DNA sample into its own labeled Eppendorf tube. Again, use a separate micropipette tip for each sample to avoid cross-contamination.
  2. Label your transfer pipettes so you will be able to distinguish them from each other. It is recommended that you label one for SYBR Green I, one for the calf thymus, one for the distilled water, and one for each DNA sample you are testing.
  3. Place a superhydrophobic glass slide into the fluorimeter with the glass side facing down.
  4. Using the SYBR Green I transfer pipette, place one droplet of SYBR Green I in each of the middle wells of the first two rows on the glass slide. The two droplets should combine into one big drop.
  5. Using the corresponding transfer pipette, add two drops of the DNA sample you are testing to the SYBR Green I drop.
  6. Adjust your smartphone camera's settings as follows: turn off the flash, set the ISO to ≥800, set the white balance to auto, set exposure and saturation to their highest settings, and set contrast to the lowest setting. Stand the smartphone upright in the cradle and set the cradle a few inches in front of the fluorimeter at a right angle to the slide.
  7. Place the light box over the entire setup and turn on the fluorimeter's light.
  8. If the smartphone has a timer setting, set it and shut the light box so photos of the drop can be taken in complete darkness. Otherwise, keep the flap lowered as much as possible while you manually take photos.
  9. Clean off the first drop and repeat steps 4-5 using the next two rows of wells and the next sample to be tested. Up to 5 samples can be tested per slide. Obtain a new slide when all rows of wells have been used.
  10. In addition to your DNA samples, you will need to test a control sample of calf thymus and a water blank. Use the corresponding transfer pipette to place droplets of calf thymus in two adjacent middle wells on a glass slide and take photos as usual. Repeat the process with distilled water for your blank.
  11. When all samples have been tested, transfer the photos from your smartphone to your computer. You will need to process a photo of each DNA sample as well as the calf thymus and water blank using Image J.
  12. Open the desired photo in Image J.
  13. In the menu, navigate to Analyze>Set Measurements and select Area Integrated Density and Mean Gray Value.
  14. Then, navigate to Image>Color>Split Channels. This splits the image into Red, Blue, and Green files. Choose the Green one.
  15. Activate the oval selection tool and use it to draw an oval around the drop.
  16. Navigate to Analyze>Measure and write down the sample numbers and measurement values.
  17. To get a reading of the background noise, draw another oval of the same size above the drop in the Green image and navigate to Analyze>Measure. Write down the sample numbers and measurement values, and be sure to distinguish them from the original drop measurements.
  18. Repeat Steps 12-17 for each photo needing processing.


Research and Development


Background on Disease Markers

The marker that is being used is rs137852453. This SNP is associated with hemophilia. Hemophilia is a condition where someone's blood is not clotting properly. Data on this particular SNP variance can be seen here: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=137852453
The associated gene change goes from a CGG (healthy gene sequence) to TGG (sequence associated with hemophilia). The gene alteration leads to a mutated human protein. It goes from R[Arg] to W[Trp]

Hemophilia is a blood disorder. There are different types or degrees of hemophilia, but is essentially just different levels of blood not clotting properly. In it's most sever cases the body can have an incredibly hard time stopping a wound from bleeding because it will not clot to form a scab. Hemophilia is more likely to appear in males than in females because it is based in the X chromosome.


Primer Design

Bottom Primer (in reverse):
TGGAATTGG T GGGTGGAAT
Top Primer (forward):
TTCAAAGCTTCAAGTATATC
These primers will attach to the other half of the DNA, but only if there is a matching genetic code for them to attach to. The top primer should always have a matching pair to attach to because there should be no genetic variance in its counterpart while the bottom primer will only match up with its corresponding strand of DNA if the genetic variance is present. A Taq DNA polymerase then connects to any attached primers, which along with MgCl2, makes it possible for free-floating nucleotides to fill in the rest of the letters missing from the DNA strand. This process is then repeated numerous times. If the mutation is not present then only the top primer will find a match and the reproduction of DNA will not show a noticeable increase. If the mutation is present in the subject's DNA then both primers will find matching pairs and create two full new sets of this sequence. As the process is repeated the amount of the sequences present will increase exponentially.


Illustration


Error creating thumbnail: File missing
Figure 1
Figure 2
Error creating thumbnail: File missing
Figure 3: The DNA that is being tested is split and if the primers can attach to a corresponding part then they do. The top primer should always have a match while the bottom primer will only match if the genetic variance is present. The rest of the DNA strands will be filled in with free floating nucleotides. Because the top primer should always have a match, it will always replicate a new set of DNA. If there is no genetic variance present in the DNA being tested then the bottom primer will not match and so, as the process is replicated, only linear growth will be seen. If the genetic variance that is being tested for is present then the bottom will also replicate a new set of DNA and so, as the process is replicated, exponential growth will be seen.
Error creating thumbnail: File missing
Figure 4


Bayesian Statistics
Because no test is completely accurate there are some useful statistics which can be calculated using Bayes rule after results are gathered. When looking at the probability that a person in a population has hemophilia, [ P(hc) ], the probability that if the test gives a positive result that you do in fact have hemophilia,[ P(T|hc) ], the probability that if the test gives a positive result that you do not have hemophilia, [ P(T|nc) ], and the probability that the test will give a positive result, [ P(T)], only three of them need to be known and then any other could be derived. This is demonstrated by the following equation:

(((100%-P(hc))x P(T|nc)) + ((P(hc) x P(T|hc)) = P(T)