BME100 s2015:Group11 12pmL5
OUR TEAM
| Role(s) | Role(s) | Role(s) | Role(s) | Role(s) | Role(s) | 
Lab 5 Write Up
Procedure
Smartphone used: LG G2
- Settings: 
 - Flash: None 
- ISO: 800 
- White balance: Auto 
- Exposure: Highest 
- Saturation: Highest 
- Contrast: Lowest 
 
- Flash: None 
*Calibration 
 
1.Turn on excitation light for the blue LED 
 
2.Turn on and adjust camera settings 
 
3.Place smartphone in the cradle at least four inches from the drop and adjust to an angle level to the drop. 
- Distance between smartphone and drop in cm: 6.5 
 
- Distance between smartphone and drop in cm: 6.5 
- Solutions Used for Calibration 
 
| Initial Concentration of 2X Calf Thymus DNA solution (μg/mL) | Volume of the 2X DNA solution (μL) | Volume of SYBR GREEN I Dye solution (μL) | Final DNA concentration in SYBR Green I solution (μg/mL) | 
| 5 | 80 | 80 | 2.5 | 
| 2 | 80 | 80 | 1 | 
| 1 | 80 | 80 | 0.5 | 
| 0.5 | 80 | 80 | 0.25 | 
| 0.25 | 80 | 80 | 0.125 | 
| 0 | 80 | 80 | 0 | 
Placing Samples into the Flourimeter 
4. Measure 80μL sample of SYBR Green I with pipettor and place it on the smooth side of the slide. 
5. Add 80μL of Calf Thymus DNA solution to the sample. 
6. Align and focus LED blue light on the drop and alight with smartphone camera. 
7. Set timer on smartphone and cover lid of flourimeter. Take three pictures of the sample.
8. Remove lid and remove 160μL sample from the slide with pipettor. Move slide to the next position. 
9. Repeat steps 4-8 with each concentration of the calf thymus solution. 
Results
| Final DNA concentration in SYBR green I solution (micro g/ml) | AREA | Mean Pixel Value | RAWINTDEN OF THE DROP | RAWINTDEN OF BACKGROUND | RAWINTDEN OF DROP - BACKGROUND | 
| 2.5 | 81092 | 70.859 | 5746070 | 8 | 5746062 | 
| 2.5 | 82700 | 69.467 | 5744959 | 0 | 5744959 | 
| 2.5 | 77680 | 70.751 | 5495904 | 8 | 5495896 | 
| 1 | 83704 | 75.577 | 6326057 | 171 | 6325886 | 
| 1 | 83704 | 74.167 | 6208047 | 192 | 6207855 | 
| 1 | 75336 | 77.527 | 5840604 | 50 | 5840554 | 
| 0.5 | 80328 | 35.314 | 2836708 | 318 | 2836390 | 
| 0.5 | 72228 | 36.903 | 2665422 | 386 | 2665036 | 
| 0.5 | 70936 | 34.501 | 2447349 | 596 | 2446753 | 
| 0.25 | 81656 | 19.544 | 1595854 | 0 | 1595854 | 
| 0.25 | 88656 | 18.95 | 1680034 | 0 | 1680034 | 
| 0.25 | 70284 | 19.27 | 1354348 | 168 | 1354180 | 
| 0.125 | 73244 | 13.314 | 975138 | 0 | 975138 | 
| 0.125 | 85796 | 14.747 | 1265242 | 0 | 1265242 | 
| 0.125 | 85777 | 14.01 | 1201748 | 0 | 1201748 | 
| 0 | 74144 | 6.263 | 464339 | 0 | 464339 | 
| 0 | 82320 | 8.993 | 740286 | 0 | 740286 | 
| 0 | 72108 | 7.733 | 557625 | 0 | 557625 | 
| Final DNA concentration in SYBR green I solution (micro g/ml) | RD-B 1 | RD-B 2 | RD-B 3 | MEAN | STANDARD DEVIATION | 
| 2.5 | 5746062 | 5744959 | 5495896 | 5662305 | 126856.9592 | 
| 1 | 6325886 | 6207855 | 5840554 | 6124765 | 192609.218 | 
| 0.5 | 283639 | 2665036 | 2446753 | 2649393 | 121761.4753 | 
| 0.25 | 1595854 | 1680034 | 1354180 | 1543356 | 163630.3069 | 
| 0.125 | 975138 | 1265242 | 1201748 | 1147376 | 58991.80222 | 
| 0 | 464339 | 740286 | 557625 | 587416 | 97997.97396 | 
MEAN/CONCENTRATION
Patient DNA
| Final DNA concentration | Area | Mean Pixel Value | RAWINTDEN OF THE DROP | RAWINTDEN OF THE BACKGROUND | RAWINTDEN DROP-BACKGROUND | 
| Positive Control | 92872 | 30.747 | 2855569 | 302544 | 2553025 | 
| Negative Control | 98174 | 21.367 | 2097704 | 0 | 2097704 | 
Section 1: Disease SNP‐specific primer design
A nucleotide is an organic molecule that serves as the subunits of nucleic acids like DNA or RNA.
Polymorphism is when two or more different sets of phenotypes exist in the same species.
The variation is found in the species Homo sapiens
 
The variation is located on chromosome 8.19956018
The clinical significance of SPN is its Pathogenic , causes Hyperlipidemia, familial combined[MedGen - OMIM
SPN is associated with genes NHGRI, GWAS, and PheGenl
Disease associated with SPN are non-alcohol fatty liver disease, heart disease, and type 2 diabetes
LPL stands for lipoprotein lipase
Functions: apolipoprotein bonding, heparin binding, lipoprotein lipase activity
An allele is a alternate form of a gene that arises by mutation found at the same place on a chromosome.
 
The disease associated allele is AGT instead of AAT
Position: 19956018 
Non-disease forward primer: 5' ATCTGGGCTATGAGATCAAT 
The numerical position of the primer 200 bases to the right is 19956218
 
Non-disease reverse primer: 5'TGGGACTCGGGACCACAAAG 
 
Disease forward primer: 5' ATCTGGGCTATGAGATCAGT 
Disease reverse primer: 5' ACTGATCTCATAGCCCAGAT