BME100 s2015:Group11 12pmL5

From OpenWetWare
Jump to navigationJump to search

OUR TEAM

Error creating thumbnail: File missing
Name: Miranda Kaml
Role(s)
Error creating thumbnail: File missing
Framarz Alam
Role(s)
Error creating thumbnail: File missing
Name: Joe Florio
Role(s)
Error creating thumbnail: File missing
Name: student
Role(s)
Error creating thumbnail: File missing
Name: student
Role(s)
Error creating thumbnail: File missing
Name: student
Role(s)

Lab 5 Write Up

Procedure

Smartphone used: LG G2

  • Settings:
    • Flash: None
    • ISO: 800
    • White balance: Auto
    • Exposure: Highest
    • Saturation: Highest
    • Contrast: Lowest

*Calibration
1.Turn on excitation light for the blue LED
2.Turn on and adjust camera settings
3.Place smartphone in the cradle at least four inches from the drop and adjust to an angle level to the drop.

    • Distance between smartphone and drop in cm: 6.5

  • Solutions Used for Calibration
Initial Concentration of 2X Calf Thymus DNA solution (μg/mL) Volume of the 2X DNA solution (μL) Volume of SYBR GREEN I Dye solution (μL) Final DNA concentration in SYBR Green I solution (μg/mL)
5 80 80 2.5
2 80 80 1
1 80 80 0.5
0.5 80 80 0.25
0.25 80 80 0.125
0 80 80 0


Placing Samples into the Flourimeter

4. Measure 80μL sample of SYBR Green I with pipettor and place it on the smooth side of the slide.
5. Add 80μL of Calf Thymus DNA solution to the sample.
6. Align and focus LED blue light on the drop and alight with smartphone camera.
7. Set timer on smartphone and cover lid of flourimeter. Take three pictures of the sample.
8. Remove lid and remove 160μL sample from the slide with pipettor. Move slide to the next position.
9. Repeat steps 4-8 with each concentration of the calf thymus solution.

Results

Final DNA concentration in SYBR green I solution (micro g/ml) AREA Mean Pixel Value RAWINTDEN OF THE DROP RAWINTDEN OF BACKGROUND RAWINTDEN OF DROP - BACKGROUND
2.5 81092 70.859 5746070 8 5746062
2.5 82700 69.467 5744959 0 5744959
2.5 77680 70.751 5495904 8 5495896
1 83704 75.577 6326057 171 6325886
1 83704 74.167 6208047 192 6207855
1 75336 77.527 5840604 50 5840554
0.5 80328 35.314 2836708 318 2836390
0.5 72228 36.903 2665422 386 2665036
0.5 70936 34.501 2447349 596 2446753
0.25 81656 19.544 1595854 0 1595854
0.25 88656 18.95 1680034 0 1680034
0.25 70284 19.27 1354348 168 1354180
0.125 73244 13.314 975138 0 975138
0.125 85796 14.747 1265242 0 1265242
0.125 85777 14.01 1201748 0 1201748
0 74144 6.263 464339 0 464339
0 82320 8.993 740286 0 740286
0 72108 7.733 557625 0 557625


Final DNA concentration in SYBR green I solution (micro g/ml) RD-B 1 RD-B 2 RD-B 3 MEAN STANDARD DEVIATION
2.5 5746062 5744959 5495896 5662305 126856.9592
1 6325886 6207855 5840554 6124765 192609.218
0.5 283639 2665036 2446753 2649393 121761.4753
0.25 1595854 1680034 1354180 1543356 163630.3069
0.125 975138 1265242 1201748 1147376 58991.80222
0 464339 740286 557625 587416 97997.97396


MEAN/CONCENTRATION

Error creating thumbnail: File missing


Patient DNA

Final DNA concentration Area Mean Pixel Value RAWINTDEN OF THE DROP RAWINTDEN OF THE BACKGROUND RAWINTDEN DROP-BACKGROUND
Positive Control 92872 30.747 2855569 302544 2553025
Negative Control 98174 21.367 2097704 0 2097704

Section 1: Disease SNP‐specific primer design

A nucleotide is an organic molecule that serves as the subunits of nucleic acids like DNA or RNA.
Polymorphism is when two or more different sets of phenotypes exist in the same species.
The variation is found in the species Homo sapiens
The variation is located on chromosome 8.19956018
The clinical significance of SPN is its Pathogenic , causes Hyperlipidemia, familial combined[MedGen - OMIM
SPN is associated with genes NHGRI, GWAS, and PheGenl
Disease associated with SPN are non-alcohol fatty liver disease, heart disease, and type 2 diabetes

LPL stands for lipoprotein lipase
Functions: apolipoprotein bonding, heparin binding, lipoprotein lipase activity
An allele is a alternate form of a gene that arises by mutation found at the same place on a chromosome.
The disease associated allele is AGT instead of AAT
Position: 19956018
Non-disease forward primer: 5' ATCTGGGCTATGAGATCAAT
The numerical position of the primer 200 bases to the right is 19956218
Non-disease reverse primer: 5'TGGGACTCGGGACCACAAAG
Disease forward primer: 5' ATCTGGGCTATGAGATCAGT
Disease reverse primer: 5' ACTGATCTCATAGCCCAGAT