BME100 s2015:Group11 12pmL5

OUR TEAM

Name: Miranda Kaml Role(s)

Framarz Alam Role(s)

Name: Joe Florio Role(s)

Name: student Role(s)

Name: student Role(s)

Name: student Role(s)

Procedure

Smartphone used: LG G2

• Settings:
  
  • Flash: None
    
  • ISO: 800
    
  • White balance: Auto
    
  • Exposure: Highest
    
  • Saturation: Highest
    
  • Contrast: Lowest
    

*Calibration
1.Turn on excitation light for the blue LED
2.Turn on and adjust camera settings
3.Place smartphone in the cradle at least four inches from the drop and adjust to an angle level to the drop.

• • Distance between smartphone and drop in cm: 6.5
    

• Solutions Used for Calibration
  

Initial Concentration of 2X Calf Thymus DNA solution (μg/mL)	Volume of the 2X DNA solution (μL)	Volume of SYBR GREEN I Dye solution (μL)	Final DNA concentration in SYBR Green I solution (μg/mL)
5	80	80	2.5
2	80	80	1
1	80	80	0.5
0.5	80	80	0.25
0.25	80	80	0.125
0	80	80	0

Placing Samples into the Flourimeter

4. Measure 80μL sample of SYBR Green I with pipettor and place it on the smooth side of the slide.
5. Add 80μL of Calf Thymus DNA solution to the sample.
6. Align and focus LED blue light on the drop and alight with smartphone camera.
7. Set timer on smartphone and cover lid of flourimeter. Take three pictures of the sample.
8. Remove lid and remove 160μL sample from the slide with pipettor. Move slide to the next position.
9. Repeat steps 4-8 with each concentration of the calf thymus solution.

Results

Final DNA concentration in SYBR green I solution (micro g/ml)	AREA	Mean Pixel Value	RAWINTDEN OF THE DROP	RAWINTDEN OF BACKGROUND	RAWINTDEN OF DROP - BACKGROUND
2.5	81092	70.859	5746070	8	5746062
2.5	82700	69.467	5744959	0	5744959
2.5	77680	70.751	5495904	8	5495896
1	83704	75.577	6326057	171	6325886
1	83704	74.167	6208047	192	6207855
1	75336	77.527	5840604	50	5840554
0.5	80328	35.314	2836708	318	2836390
0.5	72228	36.903	2665422	386	2665036
0.5	70936	34.501	2447349	596	2446753
0.25	81656	19.544	1595854	0	1595854
0.25	88656	18.95	1680034	0	1680034
0.25	70284	19.27	1354348	168	1354180
0.125	73244	13.314	975138	0	975138
0.125	85796	14.747	1265242	0	1265242
0.125	85777	14.01	1201748	0	1201748
0	74144	6.263	464339	0	464339
0	82320	8.993	740286	0	740286
0	72108	7.733	557625	0	557625

Final DNA concentration in SYBR green I solution (micro g/ml)	RD-B 1	RD-B 2	RD-B 3	MEAN	STANDARD DEVIATION
2.5	5746062	5744959	5495896	5662305	126856.9592
1	6325886	6207855	5840554	6124765	192609.218
0.5	283639	2665036	2446753	2649393	121761.4753
0.25	1595854	1680034	1354180	1543356	163630.3069
0.125	975138	1265242	1201748	1147376	58991.80222
0	464339	740286	557625	587416	97997.97396

MEAN/CONCENTRATION

Patient DNA

Final DNA concentration	Area	Mean Pixel Value	RAWINTDEN OF THE DROP	RAWINTDEN OF THE BACKGROUND	RAWINTDEN DROP-BACKGROUND
Positive Control	92872	30.747	2855569	302544	2553025
Negative Control	98174	21.367	2097704	0	2097704

Section 1: Disease SNP‐specific primer design

A nucleotide is an organic molecule that serves as the subunits of nucleic acids like DNA or RNA.
Polymorphism is when two or more different sets of phenotypes exist in the same species.
The variation is found in the species Homo sapiens
The variation is located on chromosome 8.19956018
The clinical significance of SPN is its Pathogenic , causes Hyperlipidemia, familial combined[MedGen - OMIM
SPN is associated with genes NHGRI, GWAS, and PheGenl
Disease associated with SPN are non-alcohol fatty liver disease, heart disease, and type 2 diabetes

LPL stands for lipoprotein lipase
Functions: apolipoprotein bonding, heparin binding, lipoprotein lipase activity
An allele is a alternate form of a gene that arises by mutation found at the same place on a chromosome.
The disease associated allele is AGT instead of AAT
Position: 19956018
Non-disease forward primer: 5' ATCTGGGCTATGAGATCAAT
The numerical position of the primer 200 bases to the right is 19956218
Non-disease reverse primer: 5'TGGGACTCGGGACCACAAAG
Disease forward primer: 5' ATCTGGGCTATGAGATCAGT
Disease reverse primer: 5' ACTGATCTCATAGCCCAGAT