BME100 s2014:T Group6 L4
OUR TEAM
 |
 |
 |
 |
 |
LAB 1 WRITE-UP
Initial Machine Testing
The Original Design
Open PCR is an Arduino based machine capable of performing the temperature cycling necessary to control a polymerase chain reaction. The Open PCR unit displayed in the image above was used to test human DNA for the presence of a single nucleotide polymorphism on the SUMO4 gene, located on chromosome 6. The device maintenance panel was opened to determine the function of the various components, and the control program was tested to verify the device's condition.
Experimenting With the Connections
When we unplugged the LCD screen from the Arduino circuit board, the Open PCR machine display lost power. We unplugged the white wire that connects the Arduino circuit board to the PCR tube heater, and the machine temperature reading on the LCD became erratic.
Test Run
The device was subject to a functions test on March 20, 2014. We found that the program was unable to execute heating and cooling cycles. The device was labeled fail as a consequence of the malfunction.
Protocols
Thermal Cycler Program
Initial Step:
95°C for 3 min. to bring device to initial temperature
Repeated Cycles:
1) Denature: 95°C for 30 sec. to separate DNA into two strands by breaking hydrogen bonding across base pairs
2) Anneal: 57°C for 30 sec. to allow primers to bind to specific loci
3) Extend: 72°C for 30 sec. to facilitate Taq and polymerase binding at primer
4) Final Step: 72°C for 3 min. to allow polymerase time to attach nucleotides
5) End Cycle: Ends cycle and returns to Denature step, or stops program when finished
Final Hold: 4°C to maintain finished DNA stability until the sample can be properly stored
DNA Sample Set-up
Table 1.
| Positive Control:disease DNA; Tube label:A+ | Patient 1, Replicate 1; ID:16946; Tube label:B+ | Patient 1, Replicate 2; ID:16946; Tube label:C+ | Patient 1, Replicate 3; ID:16946; Tube label:D+ |
| Negative Control: non-disease DNA; Tube label:A- | Patient 2, Replicate 1; ID:46296; Tube label:B- | Patient 2, Replicate 2; ID:46296; Tube label:C- | Patient 2, Replicate 3; ID:46296; Tube label:D- |
DNA Sample Set-up Procedure
- Step 1: Obtain two strips of four linked empty PCR tubes.
- Step 2: Label the sides of the empty tubes and place tubes in a rack.
- Step 3: Transfer 50 μL of PCR reaction mix into the empty tube labeled as the positive control.
- Step 4: Use a fresh pipette tip to transfer the "+" DNA/primer mix into the same tube.
- Step 5: Repeat steps 3 and four for the negative control, patient 1 replicates 1, 2, and 3, and patient 2 replicates 1, 2, and 3.
- Step 6: Close the lids tightly and place tubes into slots in the heating block of PCR machine.
PCR Reaction Mix
The PCR reaction mix contains Taq polymerase, a buffer solution, dNTPs (triphosphate-containing nucleotides), and divalent and monovalent cations.
DNA/ primer mix
The DNA primer mix contains a DNA template from a "patient" and a primer specifically designed to target and latch onto a specific portion of a strand of DNA that is intended to be replicated and amplified. This primer is paired with a reverse primer intended to latch on to the sister strand of DNA in the same location.
Research and Development
PCR - The Underlying Technology
-NCBI-
On November 4, 1988 the National Center for Biotechnology Information (NCBI) was established to compile a public forum molecular biology database. The NCBI is a division of the National Library of Medicine, and has networked vast amounts of genetic information including the results of the Human Genome Project. Polymerase Chain Reaction (PCR) Lab B's objective was to understand how the NCBI Database for Short Genetic Variations (dbSNP) can be used to design disease specific primers for single nucleotide polymorphism (SNP) detection.
-SNP-
SNPs occur when a single nucleotide in a gene sequence is exchanged. This does not always cause anomalous phenotypes to be expressed since amino acid production is determined by a three nucleotide sequence known as a codon, which may still produce an identical amino acid due to ambiguity in codon expression. Isoleucine, for example, will be expressed with codons ATC, ATT, or ATA. This redundancy reduces errors in protein formation.
-SUMO-
The gene of interest is known as SUMO4, which stands for "small ubiquitin-like modifier 4". This gene is found on Homo sapien chromosome 6, and has been linked to a variety of clinical conditions such as Autoimmune and Inflammatory Disease, Behcet's Disease, and an increased susceptibility for Insulin Dependent (Type I) Diabetes Mellitus. The SUMO4 point mutation occurs when the GTG codon that corresponds to valine production is transformed to the Methionine producing ATG codon. This transformation modifies a protein known IKBA which inhibits NF-kappa-B transcription factor effectively disrupting tasks such as immunoglobulin formation.
-Primer Design-
The codon responsible for the disease manifesting phenotype is located at position 149721690 on the SUMO4 gene, and can be located in the NCBI dbSNP. In order to create the disease specific primer it is necessary to select 20 nucleotides on the top DNA strand. This is accomplished by reading the primer strip from 5' to 3' (AACCACGGGGATTGTCAATG) such that the SNP bearing codon is located at the end of the 20 nucleotide primer. A second primer must be taken from the reverse strand. This reverse primer is not disease specific, and simply acts to facilitate PCR. The reverse primer was obtained from position 149721890, and also contained 20 nucleotides selected from 5' to 3' (AGTTTTCTAATTGAGAATGC).
-Expectations-
After 30 cycles there should be over 1 billion copies of the target sequence if the patient gene contains the mutated allele. If the DNA sample obtained from the selected patient does not not contain the mutation located on SUMO4, the disease specific primer will be unable to anneal to it's denatured complementary strand. If either of the primers does not bind to it's respective site PCR will be unable to effectively amplify the sample.
|}
