BME100 s2014:T Group11 L6
Xtreme OpenPCR Company Executives
 |
 |
 |
 |
 |
Computer-Aided Design
Fluorimeter
We determined that it was advantageous to include a camera as part of the device rather than using a phone camera. It provides a stable platform as well as a device standard. The camera is attached to the end of the fluorimeter so it can photograph the drop edge-on. The camera is depicted as the black dot.
PCR Block
One limitation of the OpenPCR Thermocycler is the low capacity of the PCR block. Instead of the standard 4 x 4 wells we increased the number of wells to 8 x 8 to allow for the use standard PCR tubes without cutting them. This also increases the number of possible PCR reactions in one trial.
Disease SNP
Background
The portion of DNA that will be focused on is the rs237025 sequence. This portion of DNA is found in Homo sapiens on the sixth chromosome and is associated with the SUMO4 gene. The SUMO4 gene is also known as the small ubiquitin-like modifier 4 and like the name suggests, it codes for a ubiquitin-like modifier that attaches to and effects target proteins in sub-cellular localization, stability or activity. This gene is linked to diabetes in individuals with the disease-associated allele of ATG instead of the normal GTG.
Primers
The primers that will be used to amplify the desired portion of DNA are:
Forward Primer -
5’ CTGACAATCCCCGTGGTTCA 3’
Reverse Primer –
5’ CTGCATTCTCAATTAGAAAA 3’
Consumables Kit
Materials
• PCR tubes
• Glass slides
• Micropipette tips
• Fluorimeter
• Camera
• Buffer solution
• Primer solution
• SYBR Green
Packing Method
All the consumables that are included in this kit will be packaged in durable plastic containers with packing foam padding on the inside to hold the materials in place. The buffer solution, primer solution, and SYBR Green will be packaged in their respective airtight containers to avoid contaminating the contents of the package. The PCR tubes, glass slides, and micropipette tips will all be packed separately. The fluorimeter will be packaged in its own box with packing foam around the device and included camera. Then all the parts will be grouped together in one larger box made of thicker cardboard and filled with airbags.
Hardware
PCR Machine
The PCR machine is a precisely tuned machine that goes through cycles of heating and cooling the PCR samples to specific degrees to denature the samples and then replicate the DNA. Now the new machine will have an increased number of wells, to allow the processing of more primers at a time. This increases the efficiency of the setup.
Fluorimeter
The fluorimeter’s function in the system also remains the same; after putting the SYBR Green Dye and the Calf Thymus Solution on the slide, the camera can be set to take the picture at the optimal settings with a timer. This increases efficiency by eliminating the need to pre-calibrate a phone camera.
Bayesian Statistics
Bayesian statistics were used to find the reliability of PCR for predicting the development of diabetes in human patients. In the third calculation frequencies of positive test conclusions and positive diagnosis were compared. The probability of someone with diabetes receiving a positive test result is 50%. The probability of someone who received a positive test result having or developing diabetes is 66%. In the fourth calculation frequencies of negative test conclusions and negative diagnosis were compared. The probability of someone without diabetes receiving a negative test result is 88%. The probability of someone who received a negative test result not developing diabetes is 88%. Based on the Bayesian statistics for the PCR reaction for diabetes diagnosis, PCR is not a reliable way to predict the development of diabetes.
