PCR Reaction Mix, 8 tubes 50 µL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP's
DNA/primer mix, tubes, 50 µL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
A strip of empty PCR tubes
Disposable pipettes tips:Only use each only once.Never reuse disposable pipette tips. If you do, the samples will become cross-contaminated
Cup for discarded tips
Micropipettor
Open PCR machines: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G9 +
Positive control
none
G9 -
Negative control
none
G9 1-1
Patient 1, replicate 1
77020
G9 1-2
Patient 1, replicate 2
77020
G9 1-3
Patient 1, replicate 3
77020
G9 2-1
Patient 2, replicate 1
86836
G9 2-2
Patient 2, replicate 2
86836
G9 2-3
Patient 2, replicate 3
86836
DNA Sample Set-up Procedure
DNA is extracted from the cells
Move the extracted DNA to special PCR tubes
Add the two primers to the PCR tubes to attach to the DNA sights
Add nucleotides to PCR tubes to create billions of DNA
Add DNA polymerase to PCR tube
Put the PCR tubes into the thermal cycler
Target sequence DNA is heated to 95 C in the thermal cycler
Thermal cycler cools down to 50 C
Thermal cycler rises to 72 C
OpenPCR program
Heated Lid: 100°C
Initial Step: 95°C for 2 minutes
Number of Cycles: 25
Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds
Final Step: 72°C for 2 minutes
Final Hold: 4°C
Q1: What is the function of each component of a PCR reaction?
Template DNA:
Templated used to help DNA synthesize
Primers:
Short pieces of DNA made in lab that are designed to match the segment of DNA wanted to be copied
Taq Polymerase:
The protein that used to copy a cell's DNA before it divides into two
Deoxyribonucleotides:
Building blocks that DNA molecules are made of that attach the correct complementary nucleotide to the DNA strand
Q2: What happens to the components(listed above) during each step of thermal cycling?
INITAIL STEP: 95 C for 2 minutes:
Splits DNA helix into two single standee DNA
Denature at 95 C for 30 seconds:
Primers will activate at high temperatures to move towards DNA strands
Anneal at 57 C for 30 seconds:
Primers will attach to DNA strands
Extend at 72 C for 30 seconds:
DNA polymerase will copy the DNA strand
FINAL STEP 72 C for 2 minutes:
Formation of new DNA will be created
FINAL HOLD: 4C:
Replicate the new strand of DNA
Q3: DNA is made upon four types of molecules called, nucleotides, designated as A, T, C and G. Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to each base listed below?
Adenine(A):
T
Thymine(T):
A
Cytosine (C):
G
Guanine (G):
C
Q4: During which two steps of thermal cycling does base-pairing occur?
During the Extend period, the DNA is heated up to 72 C to allow the DNA Polymerase to add the corresponding nucleotides to the new made DNA strand. Additionally, in the final step the DNA is held at a constant rate of 72 C for 2 minutes so the DNA is able to be paired up to the complementary base pair forming a new DNA strand.
SNP Information & Primer Design
Background: About the Disease SNP
Single nucleotide polymorphisms (SNP) are a type of genetic variation that is common among humans and occurs when a single nucleotide is different in one piece of DNA. Every human has about 10 million in their DNA, but most of them are harmless to the person. However, they are good markers to determine the effects medication have on people and the risk a person has of contracting a disease. The SNP focused on here is found in Homo Sapiens on the 12:40315266 chromosome. It is unsure whether the change is meaningful to patients but this condition is linked to Parkinson's Disease. At the position 40315266, the allele should contain GTG but instead, it is replaced by a GAG codon. So if the allele did not contain the disease codon, the forward primer should read 5’‐ TTAAGTGACTTGTACTTTGT -3’ and the reverse primer should read 5’‐ TGAAGCTCTTCAAGTAGTCT -3’. However, since this allele contains the disease codon the forward primer reads 5’‐TTAAGTGACTTGTACTTTGA -3’ and the reverse primer reads 5’‐ TGAAGCTCTTCAAGTAGTCT -3’.
Primer Design and TestingPrimer Design and Testing
The primer test worked for the diseased primer combination and showed that there were no matches. When the non-disease forward primer and reverse primer were entered, the chromosome received was 220bp sequence from the chromosome. When the disease forward primer and reverse primer were entered, there were no matches for this, which is the result that should have received because the data was entered into a non-disease human genome sequence.
Non-diseased primers test results:
Error creating thumbnail: File missing
Diseased primers test results:
Error creating thumbnail: File missing