DNA/primer mix, 8 tubes 50 microliters each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
A strip of empty PCR tubes
Disposable pipette tips, only use each only once. Never reuse disposable pipette tips. If you do, the samples will become cross-contaminated
Cup for discardable tips
Micropippettor
Open PCR machine: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G52 +
Positive control
none
G52 -
Negative control
none
G52 1-1
Patient 1, replicate 1
A
G52 1-2
Patient 1, replicate 2
A
G52 1-3
Patient 1, replicate 3
A
G52 2-1
Patient 2, replicate 1
B
G52 2-2
Patient 2, replicate 2
B
G52 2-3
Patient 2, replicate 3
B
DNA Sample Set-up Procedure
Step 1 Heat lid to 100*c
Step 2 95*c for 2 minutes
Step 3 there are 25 cycles
Step 4 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds
Step 5 FINAL STEP: 72°C for 2 minutes FINAL HOLD: 4°C
OpenPCR program
HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 25. Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds
FINAL STEP: 72°C for 2 minutes FINAL HOLD: 4°C
FINAL HOLD: 4°C
Research and Development
PCR - The Underlying Technology
Q.1 What is the function of each component of a PCR reaction?
Template DNA:
The strand used by DNA polymerase or RNA polymerase to attach complementary bases during DNA replication or RNA transcription
Primers:
Tool for copying very specific DNA sequences
Taq Polymerase:
Used in PCR reactions to create a complementary strand of DNA to the template
Deoxyribosenucleotides (dNTP's):
A deoxyribosenucleotide is a single unit of DNA comprised of a nitrogenous base, a deoxyribose sugar, and one phosphate group
Q.2 What happens to the components (listed above) during each step of thermal cycling?
INITIAL STEP: 95°C for 2 minutes:
DENATURE at 95°C for 30 seconds:
ANNEAL at 57°C for 30 seconds:
EXTEND at 72°C for 30 seconds:
FINAL STEP: 72°C for 2 minutes:
FINAL HOLD: 4°C
Q.3 DNA is made up of four types of molecules called nucleotides, designated as A, T, C, and G. Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to each base listed below.
Adenine (A):
T
Thymine (T):
A
Cyctosine (C):
G
Guanine (G):
C
Q.4 During which of two steps of thermal cycling does base-pairing occur? Explain your answers.
DNA base-pairing occurs during the third step of each cycle. The temperature is raised high enough to separate the DNA strand in cycle one. Primers then attach themselves to the DNA molecules as the temperature lowers. Base pairing begins in the third step when the temperature is raised slightly to allow the DNA polymerase to activate the primers. These steps are repeated for each cycle.
SNP Information & Primer Design
Background: About the Disease SNP
Single-nucleotide Polymorphism disease, commonly referred to as SNP disease is a variation in a nucleotide, often in an area of the genome that already has some sort of variation. Most often these slight variations are not life threatening, however these variations can make certain individuals more at risk for diseases. Some examples of such diseases are cystic fibrosis and sickle cell anemia. However not all variations ultimately lead to a shorter life span, for example some variations of nucleotides are known to be in relation with a lower chance of developing Alzheimers. SNP disease is the basis for much of genetic research. Association studies can help determine if a nucleotide variation is in correlation with a certain disease. Furthermore, Haplotype mapping is similar to association studies on a much larger scale. Instead of verifying if a single nucleotide is associated with a certain disease Haploype mapping uses whole set of allelels (DNA sequences) to determine linked SNPs.
Primer Design and Testing
NA (October 24)
Part 1: Use the NCBI database to find a disease-associated sequence
What is a nucelotide?
biological compound that consists of nucleotide and phosphate group, the "building blocks of DNA"
What is polymorphism
a discontinuous variation in individual's genetics that result in individual traits that make everyone different
What species is this variation found in (latin name)
Homo Sapiens
What chromosome is the variation located on?
12: 40315266
What is listed as the clinical significance of this SNP?
"uncertain significance"
What condition is linked to this SNP?
Parkinson's Disease
Part 2: Find the DNA sequence of the SNP and the surrounding sequence
What does LRRK2 stand for?
Leucine-Rich Disease
What is the function of LRRK2? To find out, click the LRRK2 link. Under Table of Contents (right side) click on Gene ontology. Write the first three unique terms you see.
provides instructions for making dardarin, active in brain and other tissues, enzyme function (kinase activity)
What is an allele?
One of two forms of a gene that can come about through mutation and are found on the same place on the chromosome
The disease-associated allele contains what codon?
GAG
The numerical position of the SNP is:
40315266
Part 3: Now that you have a good view of the DNA sequence, you can design primers for PCR.
T| border="1" cellpadding="4" cellspacing="0" style="border:#c9c9c9 1px solid; margin: 1em 1em 1em 0; border-collapse: collapse;"
Non-disease forward primer (20nt) :
5'- TTAAGTGACTTGTACTTTGT - 3'
The numerical positionexactly 200 bases to the right of the disease SNP is:
40315466 (Hint: add 200 to the position of the SNP)
BME 100 Fall 2018
