BME100 f2018:Group4 T0800 L4

From OpenWetWare
Jump to navigationJump to search

OUR TEAM

Error creating thumbnail: File missing
Name:
Alexander Sedlack
Role(s)
Error creating thumbnail: File missing
Name:
Gabe Zdrale
Role(s)
Error creating thumbnail: File missing
Name:
Dalia Khaled
Role(s)
Error creating thumbnail: File missing
Name:
Collin Conners
Role(s)
Error creating thumbnail: File missing
Name:
Jason Shenon
Role(s)

LAB 4 WRITE-UP

Protocol

Materials

  • Lab coat and disposable gloves
  • PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s

(hp://www.promega.com/resources/protocols/product‐informaon‐sheets/g/gotaq‐colorless‐master‐mix‐m714‐protocol/)

  • DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
  • A strip of empty PCR tubes
  • Disposable pipette tips:only use each only once. Never reuse disposable pipette tips. If you do, the samples will become cross‐contaminated
  • Cup for discarded tips
  • Micropipettor
  • OpenPCR machine: shared by two groups


PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G4 + Positive control none
G4 - Negative control none
G4 1-1 Patient 1, replicate 1 49532
G4 1-2 Patient 1, replicate 2 49532
G4 1-3 Patient 1, replicate 3 49532
G4 2-1 Patient 2, replicate 1 15765
G4 2-2 Patient 2, replicate 2 15765
G4 2-3 Patient 2, replicate 3 15765


DNA Sample Set-up Procedure

  1. Collect materials and add reagents (Taq DNA polymerase, MgCl2, dNTP’s, PCR reaction mix, DNA primer mix, and template DNA) to tube
  2. Mix reagents and centrifuge to collect them at the bottom of the tube
  3. Heat the reaction to 94 degrees Celsius for 15-30 seconds
  4. Lower the temperature to 54-60 degrees for 20 seconds
  5. Heat to 72-80 degrees Celsius
  6. Once DNA has been replicated, refrigerate finalized sample
  7. Repeat process for each DNA sample


OpenPCR program

  • Heated Lid: 100°C
  • INITIAL STEP: 95°C for 2 minutes
  • NUMBER OF CYCLES: 25
  • Denature at 95°C for 30 seconds, Anneal at 57°C for 30 second
  • Extend at 72°C for 30 seconds
  • FINAL STEP: 72°C for 2 minutes
  • FINAL HOLD: 4°C




Research and Development

PCR - The Underlying Technology
PCR, also known as polymerase chain reaction, is used to amplify DNA. With only one strand of DNA, a thousand strands can be achieved within a few hours. PCR uses an enzyme called DNA polymerase that creates complementary strands of DNA by adding purine and pyrimidine bases. There are three steps to make a new copy of DNA with PCR: denaturation, annealing, and extension. Each stage double the amount of DNA molecules. The PCR mixer heats or cools down the PCR mixture to allow for each of the three steps to occur at varying temperatures. To generate many copies, this process can continue for many cycles.


Q1. What is the function of each component of a PCR reaction?

In a PCR reaction there are 4 main components.The first is Template DNA. The template DNA is used for creating new strands of DNA. The next function is the Primers. Two primers are needed to signal the synthesis of DNA replication. These primers are used to mark where the replication should start by attaching to the template DNA. Taq Polymerase which is a heat resistant enzyme that reattaches molecules uses these primers to make new strands of DNA. Finally, Deoxribonucleodes or (dNTP's) are composed of three structures: a deoxyribose sugar, a phosphate group, and a nitrogen base. The nitrogen bases consist of purines (adenine and guanine) and pyrimidines (thymine and cytosine). dNTP's are used by the Taq Polymerase to make the new DNA fragments.


Q2. What happens to the components (listed above) during each step of thermal cycling?


Initial Step: 95°C for 2 minutes:

  • The polymerases are activated and the DNA is denatured.


Denature at 95°C for 30 seconds:

  • The denaturation of proteins includes the destruction of the secondary and tertiary structures. The primary structure remains the same. Hydrogen bonds are broken and DNA is denatured so that the primers can anneal in the next step.


Anneal at 57°C for 30 seconds:

  • This is where the man-made DNA primers attach to the DNA template. PCR requires two primers to attach to the two strands of DNA.


Extend at 72°C for 30 seconds:

  • The primers act as a starting point for the extension of DNA. The Taq polymerase binds to the primers and adds respective nucleotides copying the DNA in the 3’-5’ direction.


FINAL STEP: 72°C for 2 minutes:

  • This is where the copying of the strand of DNA is finalized; The strand is lengthened.


FINAL HOLD: 4°C:

  • This is when the enzymes stop continuing the reaction and the final sample is then refrigerated.

Q3. What base anneals to each base listed below?

  • Adenine(A) pairs with Thymine(T)


  • Guanine(G) pairs with Cytosine(C)


Q4. During which two steps of thermal cycling does base‐pairing occur?

  • Elongation
  • Final Elongation

The polymerase reads the DNA is the 5'-3' direction and copies the DNA is the 3'-5' direction. The DNA polymerase copies 1000 base pairs (purines or pyrimidines) per minute. This creates a new complementary strand of DNA.

SNP Information & Primer Design

Background: About the Disease SNP

What is a nucleotide?

  • A compound consisting of a nitrogenous base (ATCG), pentose sugar, and phosphate group.

What is polymorphism?

  • A discontinuous genetic variation that results in the occurrence of several different forms or types of individuals among members of a single species. (Most obvious example in humans, male and female)

What species is this variation found in?

  • Homo Sapiens

What chromosome is the variation located on?

  • 12:40315266

What is listed as the Clinical significance of this SNP?

  • Uncertain significance

What condition is linked to this SNP?

  • Parkinson’s Disease

What does LRRK2 stand for?

  • Leucine-rich repeat kinase 2

What is the function of LRRK2? (Write the first three unique terms you see)

  • The LRRK2 gene provides instructions for making a protein called dardarin. ATP binding, GTP binding, Actin binding

What is an allele?

  • One of two or more genes on a chromosome. A person theoretically gets one allele from each parent.

The disease-associated allele contains what codon?

  • GAG


Primer Design and Testing

The numerical position of the SNP is?

  • 40315266

Non-disease forward primer (20 nt):

  • TTAAGTGACTTGTACTTTGT

The numerical position exactly 200 bases to the right of the disease SNP is:

  • 40315466

Non-disease reverse primer (20 nt):

  • ACATCTTTCCTTCTTCCATG

Disease forward primer (20 nt):

  • TTAAGTGACTTGTACTTTGA

Disease reverse primer (20 nt):

  • ACATCTTTCCTTCTTCCATG