BME100 f2018:Group10 T0800 L4
|  BME 100 Fall 2018 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||
|   | |||||||||||||||||||||||||||||||||
| OUR TEAM
 LAB 4 WRITE-UPProtocolMaterials 
 
 
 
 
 
 Heated Lid: 100°C Initial Step: 95°C for 2 minutes Number of Cycles: 25 
 Final Step: 72°C for 2 minutes Final Hold: 4°C 
 
 
 Research and DevelopmentPCR - The Underlying Technology There are three main phases of thermal cycling. The first step is denaturing. During denaturing, the cycler heats up to 95°C, seperating the Template DNA protected by Taq polymerase from the coding strand and splitting the double helix. By the end of denaturing, the hydrogen bonds between the coding strand and template are completely broken. Next are the phases at which base pairing occurs. During both of the following steps, deoxyribonucleotides are added to the single-stranded template DNA based on the base-pair needed by the template, with Adenine (A) pairing with Thymine (T) and Guanine (G) pairing with Cytosine (C).The first base-pairing phase is annealing. Annealing occurs when the thermal cycler cools down to 57°C, allowing the primer molecules to pair with the single stranded template DNA. Finally, the last phase of PCR is extension. In the extension step, the thermal cycler heats up to 72°C, activating the Taq polymerase. Once activated, Taq polymerase binds to the primers and begins to add the deoxyribonucleotides. Following extension, the process is repeated until the solution is almost entirely made up of the target DNA and is held at 4°C. SNP Information & Primer DesignBackground: About the Disease SNP An allele is one of two or more alternative forms of a gene that arises by mutation and are found in the same place on a chromosome. A single-nucleotide polymorphisms (SNPs) are variations of a single nucleotide that occurs at a specific position in the genome. The variation rs721710 is found in homo sapiens and is located on the chromosome 12:40315266. The clinical significance of this SNP is uncertain but it is linked to Parkinson's disease. The name of the gene is LRRK2 which stands for leucine rich repeat kinase 2. LRRK2 is responsible for ATP binding, GTP binding, and GTP-dependent protein kinase activity. The disease-associated allele contains the codon GAG. Primer Design and Testing The numerical position of the SNP is 40315266. The non-disease forward primer is 5' TTAAGTGACTTGTACTTTGT 3' and the non-disease reverse primer is 5' TGAAGCTCTTCAAGTAGTCT 3'. The disease forward primer is 5' TTAAGTGACTTGTACTTTGA 3' and the disease reverse primer is 3'. | |||||||||||||||||||||||||||||||||






