BME100 f2017:Group11 W0800 L4

Our Team

Name: Braeden Malotky

Name: Mauro Robles

Name: Alexa Ng

Name: Keiko Ochoa

Name: Papa Magnifico

Section 1: Protocol Planning

Lab Scenario: Several patients have submitted DNA to be tested for a disease marker. Your group will receive three replicate DNA samples from two patients*. The results from all BME100 teams’ tests will eventually be collected on a master chart for statistical analysis. If you mix up or mislabel your samples, you could misdiagnose a patient.

Materials

• Lab coat and disposable gloves
• PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s
• DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
• A strip of empty PCR tubes
• Disposable pipette tips: only use each only once. Never reuse disposable pipette tips. If you do, the samples will become cross-contaminated
• Cup for discarded tips
• Micropipettor
• OpenPCR machine: shared by two groups

Tube Label	PCR Reaction Sample	Patient ID
G11 P	Positive Control	none
G11 N	Negative Control	none
G11 1-1	Patient 1, replicate 1	41233
G11 1-2	Patient 1, replicate 2	41233
G11 1-3	Patient 1, replicate 3	41233
G11 2-1	Patient 2, replicate 1	55792
G11 2-2	Patient 2, replicate 2	55792
G11 2-3	Patient 2, replicate 3	55792

Thermal Cycler heating and cooling process:

• HEATED LID: 100°C
• INITIAL STEP: 95°C for 2 minutes
• NUMBER OF CYCLES: 25
• Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and
• Extend at 72°C for 30 seconds
• FINAL STEP: 72°C for 2 minutes
• FINAL HOLD: 4°C

Section 2: Research and Development

Q1. What is the function of each component of a PCR reaction?

Question	Answer
Template DNA:	to create a complementary strand
Primers:	a custom built set of nucleotides that attaches to the template DNA to begin replication
Taq Polymerase:	a complex of proteins that copies a cell's DNA. Taq Polymerase comes from T. aquaticus, a bacterium
Deoxyribonucleotides (dNTP's):	the building blocks that DNA molecules are made of. Taq polymerase grabs floating dNTP's and attaches them to the template DNA during replication.

Q2. What happens to the components (listed above) during each step of thermal cycling?

Question	Answer
INITIAL STEP: 95°C for 2 minutes:	The template DNA double helix separates into two single-stranded parts
Denature at 95°C for 30 seconds:	The template DNA double helix separates into two single-stranded parts
Anneal at 57°C for 30 seconds:	Primer strands attach to the single-stranded DNA parts
Extend at 72°C for 30 seconds:	Taq Polymerase attaches to DNA at primer ends
FINAL STEP: 72°C for 2 minutes:	Taq Polymerase adds dNTP's to the primer strand to create a replicated DNA double helix
FINAL HOLD: 4°C:	stops the process of replication

Q3. Which base anneals to each base listed below?

• Adenine (A): Thymine (T)
• Thymine (T): Adenine (A)
• Cytosine (C): Guanine (G)
• Guanine (G): Cytosine (C)

Q4. During which two steps of thermal cycling does base-pairing occur? Explain your answer. Base-pairing occurs during the two steps at 72°C during thermal cycling. In the Extend step, Taq Polymerase attaches to the single-stranded DNA with the primer strand attached. During the Final step, the Taq Polymerase adds nucleotides (dNTP's) to the single-stranded DNA to replicate the double helix.

Section 3: Disease SNP-specific primer design

Part 1:

Question	Answer
What is a nucleotide?	The basic building block (monomer) of DNA and RNA. A nucleotide consists of a five-carbon sugar end, a nitrogenous base (cytosine, guanine, adenine, thymine, and uracil), and the phosphate backbone. In both DNA and RNA, each base has a compliment, which together forms a base pair.
What is a polymorphism?	Any genetic difference between two individuals within a given species. In the context of SNPs, a polymorphism is a change in the DNA that allows for an individual to be distinguished genetically from another. This can be a point mutation or a frameshift mutation.
What species is this variation found in? (Latin name)	This gene is found in the species Homo sapiens.
What chromosome is the variation located on?	This SNP is located on chromosome 19:44907853.
What is listed as the Clinical significance of this SNP	This SNP is labeled as "pathogenic" under the Clinical Significance section.
What condition is linked to this SNP?	Alzheimers is associated with this specific SNP.

Part 2:

Question	Answer
What does APOE stand for?	APOE stands for Apolipoprotein E.
What is the function of APOE	Lipid binding, phospholipid binding, protein binding are all functions of APOE.
What is an allele?	Alleles are differences between one gene and another from the same location in a genome caused by mutations.
The disease-associated allele contains what codon?	The alternative variant of the codon CTG is CCG, which is associated with Alzheimer's disease.
Record the numerical position of SNP rs769452	This SNP is located at 44907853.

Part 3:

Question	Answer
Non-disease forward primer (20nt):	5' AGCGGCCAGCGCTGGGAACT 3'
Numerical position exactly 200 bases to the right of the disease SNP	44908053
Non-disease reverse primer (20nt):	5' CAGGCCCCCCAAGACTTAGC 3'
Disease forward primer (20nt):	5' AGCGGCCAGCGCTGGGAACC 3'
Disease reverse primer (20nt):	5' CAGGCCCCCCAAGACTTAGC 3'