BME100 f2015:Group8 1030amL4

BME 100 Fall 2015	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Error creating thumbnail: File missing Name: Sydney Connor Role(s) Error creating thumbnail: File missing Name: Michael Dagher Role(s) Error creating thumbnail: File missing Name: Tajinder Virdee Role(s) Error creating thumbnail: File missing Name: Angela Hemesath Role(s) Error creating thumbnail: File missing Name: Olivia Gonzalez(s) Error creating thumbnail: File missing Name: Alaina Jenish Role(s) LAB 4 WRITE-UP Protocol Materials Lab coat and gloves PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2 , and dNTP’s DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer A strip of empty PCR tubes Disposable pipette tips: only use each only once. Be sure not to use pipette tips twice because samples will be cross-contaminated Waste cup for diposal tips Cup of ice Micropipettor OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G8 + Positive control none G8 - Negative control none G8 1-1 Patient 1, replicate 1 61878 G8 1-2 Patient 1 replicate 2 61878 G8 1-3 Patient 1, replicate 3 61878 G8 2-1 Patient 2, replicate 1 40819 G8 2-2 Patient 2, replicate 2 40819 G8 2-3 Patient 2, replicate 3 40819 DNA Sample Set-up Procedure Gather all of the materials listed above Label all 8 50μL tubes(G8 P, G8 N, G8 1-1, G8 1-2, G8 1-3, G8 2-1, G8 2-2, G8 2-3) After gathering samples place all DNA samples, Primers, etc. on the cup of ice Place no more than 50μL of each DNA/Primer mix into the corresponding tubes using a micropipette set at the correct volume Using a micropipette add 50μL of PCR mix (primers, nucleotides, and DNA polymerase) to the PCR tube Insert the PCR tube in to the thermal cycler Repeat Steps above with each DNA sample Place all samples in thermal cycler and start the machine OpenPCR program HEATED LID: 100°C INITIAL STEP: 95°C for 2 minutes NUMBER OF CYCLES: 25 Denature at 95°C for 30 seconds Anneal at 57°C for 30 seconds Extend at 72°C for 30 seconds FINAL STEP: 72°C for 2 minutes FINAL HOLD: 4°C Research and Development PCR - The Underlying Technology What is the function of each component of a PCR reaction? The components of a PCR reaction include the DNA template, primers, Taq Polymerase, and deoxyribonucleotides. The function of the DNA template (represented below) is the basic genetic code meant to be copied and replicated. picture source: http://learn.genetics.utah.edu/content/labs/pcr/ The primers (shown below) are small fragments of DNA which bind to specific sites on the DNA template which facilitate the attachment of the Taq polymerase and start DNA replication at specific sites. picture source: http://learn.genetics.utah.edu/content/labs/pcr/ The Taq Polymerase(shown below)is a heat-activated polymerase, which attaches to the primers and builds and replicates a second DNA strand from the template DNA. picture source: http://learn.genetics.utah.edu/content/labs/pcr/ The deoxribonucleotides (shown below) are components of DNA (adenine, guanine, cytosine, thymine) which are needed to replicate the DNA. They are used as building blocks of DNA, and are added to the replicated strand by the Taq Polymerase. picture source: www.shmoop.com What happens to the components (listed above) during each step of thermal cycling? INITIAL STEP: 95°C for 3 minutes: This step activates hot-start primers and leads into the denaturation step. Denature ​at 95°C for 30 seconds: This breaks the hydrogen bonds and separates the two DNA strands. Anneal​ at 57°C for 30 seconds: The primers bind to their complementary sequence in the DNA template. Extend ​at 72°C for 30 seconds: DNA polymerase extends the primers by sequencing complementary nucleotides. FINAL STEP: 72°C for 3 minutes: This is done to ensure that any remaining single strands are extended. FINAL HOLD: 4°C: The DNA is kept at this temperature for analysis and storage. Which base anneals to each base below? Adenine always binds with Thymine. Guanine always bind with Cytosine. During which two steps of thermal cycling does base-pairing occur? Explain your answers. Base-pairing occurs during annealing and extension. During the annealing step, the primers must use base-pairing to bind to their sequence. In extension, base-pairing occurs as DNA polymerase completes the DNA strand. SNP Information & Primer Design Background: About the Disease SNP SNP is commonly known as "single nucleotide polymorphism." This particular SNP is referred to as clear cell renal cell carcinoma or kidney cancer.To distinguish this SNP on the cellular level, the malignant epithelial cells have clear cytoplasm and a distinguished pattern of growth. On the genetic level, SNP is characterized by a specific 5' group of DNA located at the chromosome position 16:89919736 and associated with the MC1R gene. The MC1R (melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) gene is responsible for coding the receptor protein for melanocyte-stimulating hormone. What causes the gene to malfunction and eventually lead to SNP is when the allele at rs1805008 position 1858 is changed from CGG to TGG. Primer Design and Testing With the primer test, it was discovered that everyone has the non-diseased primers. However, what gives someone a specific disease are the unique changes in their DNA sequence. Someone may have the same disease as another, but it may have been caused by a different genetic mutation. The non-disaesed primers used were: CAGCATCGTGACCCTGCCGC CTTGTGGAGCCGGGCGATGC The diseased primers used were: CAGCATCGTGACCCTGCCGC GTCGTAGCACTGGGACGGCG There were no matching primers because it is a diseased primer and would not be included in the normal human genome.