BME100 f2015:Group7 1030amL4
| Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||
|
OUR TEAMLAB 4 WRITE-UPProtocolMaterials
, and dNTP’s
have the same forward primer and reverse primer
samples will be cross-contaminated
Research and DevelopmentPCR - The Underlying Technology Template DNA is the original DNA that is split and is used for primers to copy its DNA. Primers are components that attach onto specific sites on DNA strands to helps start off the process of copying the DNA. In order to copy the DNA with the primers, Taq Polymerase comes into play. They act as machines that attach Deoxyribonucleotides (the A's, C's, T's, and G's that make up DNA. They are the building blocks that code DNA that can be turned on and off for different functions) to the template DNA to make DNA copies. Question 2: What happens to the components (listed above) during each step of thermal cycling? The thermal cycling process occurs by first going through the initial step of 95°C for 3 minutes by having the DNA double helix separating. Denature at 95°C for 30 seconds occurs when the double helix creates two single stranded DNA molecules. During anneal at 57°C for 30 seconds the single stranded DNA attempts to pair up but is prevented by the primer. During extend at 72°C for 30 seconds, DNA polymerase activates adding nucleotides onto the DNA strands by locating primers. The final step at 72°C for 3 minutes creates an overall result of two double strands of DNA. The final hold at 4°C would be the whole process repeating itself by creating several fragments. Question 3: The nucleotides Adenine pairs up with Thymine and Cytosine pairs up with Guanine. Base Anneals: Adenine (A): Thymine (T) Thymine (T): Adenine (A) Cytosine (C): Guanine (G) Guanine (G): Cytosine (C) Question 4: During which two steps of thermal cycling does base-pairing occur? Explain your answers. Thermal cycling does base-pairing in Anneal and Extend. In Anneal the primers are also DNA fragments which have nucleotides that pair up with a certain site on the template DNA. And for Extend, DNA polymerase adds nucleotides onto the DNA stand.
SNP Information & Primer DesignBackground: About the Disease SNP A diseased single nucleotide polymorphism is a change in a single nucleotide, which is one of the four bases; Adenine, Cytosine, Guanine, Thymine. This change causes a change in the way polymerase reads and produces the sub sequential proteins. In our lab we were given a strand of DNA from the Homo Sapien species which had a single nucleotide polymorphism on chromosome 16:89919736. This chromosome is relate to the MC1R gene and relates to the disease renal cell carcinoma or a combination of melanoma and Parkinson's. The MC1R stands for melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor). One of the functions of MC1R is g-protein couple with peptide receptor activity. Another function is MC1R binds proteins. The third function is MC1R has melonocmratin receptor activity. An allele is a form of a gene that is found through mutation and found in the same position as the original gene. In the gene the allele is mutated seeing a change in the original code from CGG to TGG Position:89919736 Diseased: 5'-CAGCATCGTGACCCTGCCGT
5'-CAGCATCGTGACCCTGCCGC
Position:89919936 5'-GGCATCGCCCGGCTCCACAA
Disease Forward Primer: 5' CAGCATCGTGACCCTGCCGT 5' GTCGTAGCACTGGGACGGCA Primer Design and Testing When i tested the non-disease primers on the website my search results did indeed reveal the same 220 bp sequence in the fourth chromosome. Then when i put in the disease primers the resulting search yielded no matches. This is probably because the disease has not been seen in the been mapped in the Human Genome because it was eradicated before the project started and was therefore unmapped.
| ||||||||||||||||||||||||||||||||||





