|
OUR TEAM
LAB 4 WRITE-UP
Protocol
Materials
- Lab coat and disposable gloves
- PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s
- DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
- A strip of empty PCR tubes
- Disposable pipette tipes: only use each only once. Never re-use disposable pipette tips or samples will be cross-contaminated.
- Cup for discarded tips
- Micropipettor
- OpenPCR machine: shared by two groups
PCR Reaction Sample List
| Tube Label |
PCR Reaction Sample |
Patient ID
|
| G6 + |
Positive control |
none
|
| G6 - |
Negative control |
none
|
| G6 1-1 |
Patient 1, replicate 1 |
78778
|
| G6 1-2 |
Patient 1, replicate 2 |
78778
|
| G6 1-3 |
Patient 1, replicate 3 |
78778
|
| G6 2-1 |
Patient 2, replicate 1 |
63691
|
| G6 2-2 |
Patient 2, replicate 2 |
63691
|
| G6 2-3 |
Patient 2, replicate 3 |
63691
|
DNA Sample Set-up Procedure
- Separate PCR tubes and label accordingly
- Ensure each PCR tube has 50 microliters of PCR mix
- Pipette 50 microliters of each DNA/primer mix into their respective tubes
- Close off the tubes
- Put the tubes into the termal cycler (denature, anneal, extend, etc.)
OpenPCR program
HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 25
- Denature at 95°C for 30 seconds
- Anneal at 57°C for 30 seconds
- Extend at 72°C for 30 seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C
Research and Development
PCR - The Underlying Technology
PCR Component Functions
The Template DNA is the segment of DNA that is being amplified using PCR. Laboratory-made Primers are segments of DNA that correspond to the Template DNA. One Primer attaches to the top strand of the Template DNA at one end, and the other Primer attaches to the bottom strand of DNA at the other end. Taq Polymerase is a protein complex that bumps into the Primers on the Template DNA. When DNA Polymerase attaches to a Primer, it adds Nucleotides until it reaches the end of the sequence. Nucleotides are building blocks of DNA: Adenine, Cytosine, Guanine, and Thymine.
Thermal Cycling
DNA PCR is a way to amplify the DNA that the researcher wants to see by making billions of copies of the Target Sequence. It consists of an initial step of Denaturing at 95 degrees Celsius for 3 minutes; once this temperature is reached, DNA strands separate in a 30 second process. Then, the temperature is lowered to 57 degrees Celsius, so DNA Primers can Anneal to the Target Sequence for a 30 second step. The temperature is then raised to 72 degrees Celsius for 30 seconds; once this temperature is attained, DNA Polymerase is activated to add the complementary nucleotides to the Target DNA. These 3 30-second steps are repeated for 25 cycles to make billions of copies of Target DNA. Then, a final 3 minute extending step at 72 degrees Celsius occurs to ensure DNA polymerase finishes adding nucleotides. Once amplified, the DNA is held at 4 degrees Celsius, the temperature appropriate for storing DNA.
Nucleotides
DNA base-pairing depends on the structure of the four nucleotide types found in DNA. Adenine pairs to Thymine, Thymine pairs to Adenine, Cytosine pairs to Guanine, and Guanine pairs to Cytosine.
Base-Pairing Steps
DNA base-pairing occurs at the Annealing phase, when Primers bind to the Target DNA, and in the Extension phase, when DNA Polymerase adds complementary base pairs to the Target Strand.
Background: About the Disease SNP
The nucleotides are structural components of DNA and RNA. A Polymorphism is a genetic variation in a population that is acceptable by natural selection (it will be able to survive and reproduce in its environment). rs1805008 is a SNP found in homo sapiens on chromosome 16. It is a pathogenic SNP, associated with the MC1R gene. This gene, melanocortin 1 receptor (MC1R), regulates mammalian skin and hair cell production, and is associated primarily with susceptibility to Clear Cell Renal Cell Carcinoma. An allele is one of two or more alternative forms of a gene at the same place on the chromosome, which arise from a mutation. This allele change leading to the SNP occurs when CGG mutates to TGG.
Primer Design and Testing
The non-disease forward primer is CAGCATCGTGACCCTGCCGC, which contains the "C" that would mutate to a "T" if it were an SNP. It is at numerical position 89919936. The non-disease reverse primer is CTTGTGGAGCCGGGCGATGC, which is 200bp to the right of numerical position 89919936. The disease forward primer is CAGCATCGTGACCCTGCCGT, which is identical to the non-disease forward primer except it contains the SNP ("C" to "T"). The disease reverse primer is CTTGTGGAGCCGGGCGATGC, which is 200 bp to the right of the SNP, identical to non-disease reverse primer.
We validated our results using the UCSC non-disease DNA sequencing resource.
|