|
OUR TEAM
LAB 4 WRITE-UP
Protocol
Materials
- a. Lab coat and disposable gloves
- b. PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2
, and dNTP’s
- c. DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes
have the same forward primer and reverse primer
- d. A strip of empty PCR tubes
- e. Disposable pipette tips: only use each only once. Never re-use disposable pipette tips or
samples will be cross-contaminated
- f. Cup for discarded tips
- g. Micropipettor
- h. OpenPCR machine: shared by two groups
PCR Reaction Sample List
| Tube Label |
PCR Reaction Sample |
Patient ID
|
| G5 + |
Positive control |
none
|
| G5 - |
Negative control |
none
|
| G5 1-1 |
Patient 1, replicate 1 |
16274
|
| G5 1-2 |
Patient 1, replicate 2 |
16274
|
| G5 1-3 |
Patient 1, replicate 3 |
16274
|
| G5 2-1 |
Patient 2, replicate 1 |
42480
|
| G5 2-2 |
Patient 2, replicate 2 |
42480
|
| G5 2-3 |
Patient 2, replicate 3 |
42480
|
DNA Sample Set-up Procedure
- Prepare the DNA samples, primer solutions, DNA Polymerase Solution, and the nucleotide solution.
- Place each solution in clearly labeled containers.
- Use micropipetting to move the required amounts of each solution into two other clearly labeled PCR tubes to test each DNA sample for the first times. Change the tip of the micropipette each time after every use to prevent contamination.
- Place the completed solutions in the DNA Thermalcycler and wait for it to finish cycling through temperatures.
- Record the results.
OpenPCR program
A PCR is capable of generating 100 billion copies of a specific DNA sequence in hours. To begin, DNA extracted from cells is first needed. The DNA is then placed into tubes with 2 primers.
Primers attach to sites of the DNA at either end segments of DNA that is desired to be copied. Nucleotides are then added to the mixture as building blocks of the new gene. DNA Polymerase is also added.
DNA Polymerase is a protein that creates copies of DNA code. The PCR mixture is then placed in a DNA Thermal Cycler. The Thermal Cycler will heat and cool the mixture in the tube to make the reaction work. At cycle 1, the thermal cycler heats up to 95 degrees Celsius.
The DNA strands split at this temperature. Then the thermal cycler cools to 50 degrees Celsius. At this temperature the DNA molecules will try to pair up again but won’t be able to because too many primers are in the way for them to bond.
The thermal cycler then heats up to 72 degrees Celsius. This activates DNA Polymerase. DNA Polymerase locates a binding site and then adds complementary nucleotides onto the strand. After that, the first cycle is then complete. The same steps happen in cycle 2.
During cycle 3, the desired products begin to appear. At the end of cycle four there are 8 fragments that contain the target sequence of interest. At cycle 5, 22 fragments of the target sequence is found. This process is repeated until billions of copies of the desired sequence are found.
This is the OpenPCR program
Error creating thumbnail: File missing
Research and Development
PCR - The Underlying Technology
Error creating thumbnail: File missing
PCR reactions include template DNA which is the DNA replicated until it is the main part of the solution and can easily be tested. Template DNA is denatured at 95 degrees after losing its helix structure in the initial step. It binds to a Primer at 57 degrees and is copied by Taq Polymerase at 72 degrees and during the Final Step. The Final Hold allows the DNA to return to a stable shape to be copied again.
The PCR reactions also include Primers. Primers bind to the 5’ end of a sequence of template DNA and mark that sequence for coping by the Taq Polymerase. Primers are present in the solution but don’t do anything until the temperature of the solution is decreased to 57 degrees at which point they attach to the DNA Template. At 72 degrees Taq Polymerase attaches to the Primer and the Primer is finished being used in the process since it simply becomes part of the copied strand of DNA.
Taq polymerase is a protein that is present in the solution through the whole process but doesn’t do anything until the temperature reaches 72 degrees after the Primer binds. At this point, the protein starting at the primer, goes down the DNA and binds nucleotides to the DNA Template to make a copy strand. It does this until the Final Hold step when it detaches.
The Deoxyribonucleotides are the molecules used by the Taq Polymerase to copy DNA. The DNPs remain unaffected in the solution until the solution reaches 72 degrees and the Taq Polymerase uses them to assemble a corresponding strand of DNA. The DNPs link together, remain as a strand of DNA through the Final Hold, and are copied by more DNPs in the next cycle.
Each single strand of DNA is basically contains of four types of molecules called nucleotides. Each nucleotide in a single strand normally sticks only and only with a specific kind of nucleotide in another single strand of DNA that results a double strand DNA. The four nucleotides are Adenine (A), Thymine (T), Cytosine (C), and Guanine (G). The base Adrenine (A) only sticks with the base Thymine (T). Therefore, even the base Thymine only sticks with the base Adenine (A). In addition, the base Cytosine only connects with the base Guanine (G). For that, the base Guanine (G) only sticks with the base Cytosine (C) that results a base pair.
Since base-pairing is "the process of bringing together separate sequences of DNA and RNA by the bonding of the base pairs", base-pairing presents in the anneal and extend step. In the anneal step, primers attach with nuclotides of interest in single strand DNA to copy it. In the extend step, the Taq polymerases attach near the primear to extend the other strand to have a double-stranded DNA or base pairs of nucleotides.
Background: About the Disease SNP
SNP is an acronym for single nucleotide polymorphism. Each word in the acronym will be evaluated carefully to get a clear understanding what a SNP is and how it can cause a disease. A nucleotide is a basic building block of nucleic acid (found in DNA). There are four main nucleotides in a strand of DNA. Those four standard nucleotide bases are adenine, cytosine, guanine, thymine (a, c, g, and t respectively). The adenine usually pairs up with the thymine and the guanine usually pairs up with the cytosine. A polymorphism is when a base pair is not matched up in the order as described above. When a polymorphism occurs, proteins can be rendered as ineffective and diseases can ensure to persist. In general, a SNP is when a single nucleotide base pair varies from the appropriate nucleotide pairs that supposed to be in a gene. A SNP contributes strongly to disease.
The SNP being evaluated in this lab is a SNP labeled rs1805008. This variation is found in Homo sapiens and is located on chromosome 16:89919736. The clinical significance of this SNP is that it is pathogenic and the genes that this SNP is associated with is MC1R. MC1R is a protein coding gene. Three functions that MCR1 is associated with are G-protein coupled peptide receptor activity, hormone binding, and melanocortin receptor activity. Diseases that are associated with MCR1 mutations can cause easier damaging to the skin via UV radiation, albinism, and other complications with the skin.
Primer Design and Testing
In order to develop an effective primer, a mutated allele must be fixed. An allele is simply an alternative form of a gene that can be caused by a mutation. Non-disease allele contains CGG respectively in that order. Changes in the C position of that allele are linked to disease. Disease-associated alleles contain a TGG sequence.
When searching for a primer to develop for rs1805008, the numerical position of the SNP’s first needed to be found. The position was 89919736. The TGG mutation was then found and a primer was made to replace it. To find the reverse primer, the nucleotide sequence had to be read from left to right starting with the nucleotide at the position of 89919936.Here are the final primers that were constructed.
The Following Primers Were Evaluated:
Non-disease forward primer (20 bases): 5’ – cagcatcgtgaccctgccgc
Non-disease Reverse primer (20 bases): 5’- cttgtggagccgggcgatgc
Disease Forward primer (20 bases): 5’ - cagcatcgtgaccctgccgt
These are results from the non-disease primers.
Error creating thumbnail: File missing
These are results from the disease primers.
Error creating thumbnail: File missing
|