BME100 f2015:Group5 1030amL4

BME 100 Fall 2015	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Doug Brown Role(s) Name: Taylor Barda Role(s) Name: Mary Cauley Role(s) Name: Steven Stamm Role(s) Name: Andrew Soich Role(s) Name: Alexandra Davis Role(s) LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix 8 tubes 50 μL each: Taq DNA polymerase MgCl2 dNTP's (http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorless-master-mix-m714-protocol/) DNA/primer mix 8 tubes 50 μL each: Each mix contains a different template of DNA. All tubes have the same forward primer and reverse primer. A strip of empty PCR tubes Disposable pipette tips: only use each only once. Never re-use disposable pipette tips or samples will be cross-contaminated Cup for discarded tips Micropipettor OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G5 + Positive control none G5 - Negative control none G5 1-1 Patient 1, replicate 1 51283 G5 1-2 Patient 1, replicate 2 51283 G5 1-3 Patient 1, replicate 3 51283 G5 2-1 Patient 2, replicate 1 60999 G5 2-2 Patient 2, replicate 2 60999 G5 2-3 Patient 2, replicate 3 60999 DNA Sample Set-up Procedure Step 1 Step 2 Step 3... OpenPCR program Heated Lid: 100°C Initial Step: 95°C for 2 minutes Number of Cycles: 25 Denature at 95°C for 30 seconds Anneal at 57°C for 30 seconds Extend at 72°C for 30 seconds Final Step: 72°C for 2 minutes Final Hold: 4°C Research and Development PCR - The Underlying Technology Template DNA is a strand of DNA contains the targeted sequence of DNA that we are going to isolate with primers and mass replicate through PCR. Primers are single-stranded DNA sequences that complement the starting codon sequence. Primers are highly specific, targeting a specific sequence of DNA. DNA polymerase II begins the replication process of the target sequence starting from the end of the primer once it is bond to its complementary sequence. Taq polymerase is a DNA polymerase II enzyme taken from Thermus aquaticus - an organism that lives in extremely high temperatures such as in hot springs or vents. Due to its environment, the DNA of T. aquaticus can withstand extreme temperatures without denaturing, unlike human DNA. This characteristic of T. aquaticus DNA allows us to use enzymes from said organism to replicate a target sequence of DNA via thermoshock without destroying the enzymes needed to replicate the sequence. The general term used to describe the four deoxyribonucleotides - dCTP, dGTP, dATP, and dTTP - is 'dNTPs.' During the initial step of thermal cycling, the double-stranded DNA is straightened and separated in a process known as denaturing, which occurs at high temperatures around boiling (95 C). The temperature is then cooled to approximately 55 C to 57 C and the primers attach to the separated single-strands - known as annealing. The temperature is then raised slightly to approximately 70 C to 72 C to allow Taq polymerase to bind to the primers and begin replicating the single-strands. During this replication process, Taq polymerase adds dNTPs to the single-strands, executing the replication. The temperature is then lowered to 4 C to prepare the new double-stranded DNA sequences for the next cycle of thermal shock. Adenine (A) anneals to Thymine (T) and vice versa whilst Cytosine (C) anneals to Guanine (G) - also vice versa. Base-pairing occurs during the annealing and the extending phases. During the annealing phase, the nucleotide sequence of the primer must successful pair with the correct nucleotide sequence on the single-stranded DNA. During the extending phase, Taq polymerase adds complementing nucleotides to the target sequence, replicating and extending it. SNP Information & Primer Design Background: About the Disease SNP Nucleotides are organic molecules that are the "building blocks" of DNA. These "building blocks" are known more specifically as adenine, cytosine, thymine, and guanine. When two or more clearly different phenotypes exist in the same population of a species - we call it a polymorphism. When referencing the term "Disease SNP," we associate it with a single change in one of the bases, in turn causing the creation of undesired proteins and possibly leading to serious diseases. Our SNP variation is found in Homo Sapiens on chromosome 16. This pathogenic SNP is known to be directly associated with the MC1R gene - a marker for melanoma. MC1R - or Melanocortin 1 receptor - functions as an encoder for a receptor protein for the alpha melanocyte stimulating hormone receptor. For this specific disease, the disease-associated allele contains the TGG sequence. Numerical Position: 89919736 (Numerical Position 200 bases to the right would be 89919936) Non-Disease Forward Primer (20nt): 5' - CAGCATCGTGACCCTGCCGC Non-Disease Reverse Primer (20nt): 5' - CTTGTGGAGCCGGGCGATGC Disease Forward Primer: 5' - CAGCATCGTGACCCTGCCGG Disease Reverse Primer: 5' - CTTGTGGAGCCGGGCGATGC Primer Design and Testing For the non-disease forward primer and the non-disease reverse primer, our tested and validated results were chromosome 16 and 220 base pairs (B.P.). As for the disease specific primers, the tested and validated results got no matches.