BME100 f2015:Group1 8amL4

From OpenWetWare
Jump to navigationJump to search
BME 100 Fall 2015 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR TEAM

Error creating thumbnail: Unable to save thumbnail to destination
Name: Tiffany Nguyen
Error creating thumbnail: Unable to save thumbnail to destination
Name: Maria Dooling
Error creating thumbnail: Unable to save thumbnail to destination
Name: Brenden Smith
Error creating thumbnail: Unable to save thumbnail to destination
Name: Nathaniel Olsen
Error creating thumbnail: Unable to save thumbnail to destination
Name: Nolverto Guiterrez
Error creating thumbnail: Unable to save thumbnail to destination
Name: Dalia Sarbolandi

LAB 4 WRITE-UP

Protocol

Materials

  • Lab coat and disposable gloves
  • PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl​, and dNTP’s
  • DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
  • A strip of empty PCR tubes
  • Disposable pipette tips: only use each only once. Never re-use disposable pipette tips or samples will be cross-contaminated
  • Cup for discarded tips
  • Micropipettor
  • OpenPCR machine: shared by two groups

PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G1 + Positive control none
G1 - Negative control none
G1 1-1 Patient 1, replicate 1 31801
G1 1-2 Patient 1, replicate 2 31801
G1 1-3 Patient 1, replicate 3 31801
G1 2-1 Patient 2, replicate 1 21190
G1 2-2 Patient 2, replicate 2 21190
G1 2-3 Patient 2, replicate 3 21190


DNA Sample Set-up Procedure

  1. Step 1: Get DNA that has been extracted from cells
  2. Step 2: Move extracted DNA into a special PCR tube
  3. Step 3: Add Primer 1 to the PCR tube, primers attach to sites on the DNA strands
  4. Step 4: Add Primer 2, which will attach to the second site
  5. Step 5: Add nucleotides to your PCR tube
  6. Step 6: Add DNA polymerase to the PCR tube
  7. Step 7: Place PCR tube into a DNA thermal cycler


OpenPCR program

  • HEATED LID: 100°C
  • INITIAL STEP: 95°C for 2 minutes
  • NUMBER OF CYCLES: 25 (Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, Extend at 72°C for 30 seconds)
  • FINAL STEP: 72°C for 2 minutes
  • FINAL HOLD: 4°C






Research and Development

PCR - The Underlying Technology
Question 1: What is the function of each component of a PCR reaction?

The function of Template DNA is to be used to create a complementary strand of DNA. The function of Primers is that two primers are designed to complement the segment of DNA that is to be copied. By means of complementary base pairing, one primer will attach to the top strand at one of the segment of interest, and the other primer attaches to the bottom at the other end of the other strand. The function of Taq polymerase, is to copy a cell’s DNA before it separates into two parts. The function of Deoxyribonucleotides (dNTP’s)​ are to be the building blocks of new DNA strands.

Question 2: What happens to the components (listed above) during each step of thermal cycling?

During initial step which is at 95°C for 3 minutes, DNA double helix separates, creating two single-stranded DNA molecules. Same thing happens at step 2, temperature is raised to separate DNA strands. During denature ​at 95°C for 30 seconds, DNA strands split from each other. During anneal​ at 57°C for 30 seconds, single stranded DNA pairs try to pair up, primers will attach. In step 2, the same thing will happen, while temperature is lowered so primers will attach. Extend​ at 72°C for 30 seconds will activate DNA polymerase(begins to add complementary nucleotides to strand when primer is located on a single strand of DNA). It continues until it gets to the end of the strand and falls off. During the final step at 72°C for 3 minutes, Polymerase synthesizes a new dna strand complementary to the dna template strand by adding. And at the final hold at 4°C ensures that any single strains are fully extended.After the final hold from 4-15°C will be held for an indefinite time for short term storage of the reaction.

Question 3: DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G. Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to each base listed below?

(A) Adenine - (T) Thymine

(T) Thymine - (A) Adenine

(C) Cytosine - (G) Guanine

(G) Guanine- (C) Cytosine

Question 4: During which two steps of thermal cycling does base-pairing occur? Explain

During Anneal at 57°C for 30 seconds, where single stranded DNA pairs try to pair up, and primers will attach. And also during step two, where the process will occur again, while the temperature is lowered so that the primers will attach, and begin to add complementary nucleotides to the single strand of DNA, until it comes to the end, where the primer will then fall off.





SNP Information & Primer Design

Background: About the Disease SNP

A nucleotide is a compound consisting of a nucleoside linked to a phosphate group which forms the basic structural unit of nucleic acids. A polymorphism is the presence of genetic variation within a population, upon which natural selection can operate. This variation is found in Homo Sapiens and is located in the chromosome, 16:89919736. The clinical significance of this SNP is that it is pathogenic. SNP is associated with the gene MC1R. The diseases which are linked to this SNP includes heart disease, diabetes, and cancer.

Primer Design and Testing

MC1R stands for melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor). Its function consists of encoding the receptor protein for melanocyte-stimulating hormone. The first three unique terms we saw were peptide, melanocortin, and ubiquitin. Allele is one of two or more alternative forms of a gene that arise by mutation and are found at the same place on a chromosome. The disease-associated allele contains the sequence TGG. The numerical position of the SNP was 89919736. The non-disease forward primer was 5'CAGCATCGTGACCCTGCCGC. The numerical position exactly 200 bases to right of the disease SNP was 89919936. The non-disease reverse primer was 5'CTTGTGGAGCCGGGCGATGC. The disease forward primer was 5'CAGCATCGTGACCCTGCCGT and the disease reverse primer was 5'CTTGTGGAGCCGGGCGATGC.

Error creating thumbnail: Unable to save thumbnail to destination