BME100 f2015:Group16 1030amL4
|  BME 100 Fall 2015 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||
|   | ||||||||||||||||||||||||||||||||||
| 
 OUR TEAMLAB 4 WRITE-UPProtocolMaterials 
 
 PCR Reaction Sample List 
 
 1) In order to perform a Polymerase Chain Reaction (PCR), DNA must be collected from cells from a source such as hair follicles. 2) Following this, the DNA should be extracted from the source into a designated PCR tube 3) Then, the initial primer should be extracted and inserted into the same designated PCR tube 4) The second primer is then extracted and released into the same designated PCR tube 5) Nucleotides are then added to the PCR tube in order to provide the needed building blocks when the DNA replicates 6) The final thing to be added is DNA polymerase that commences the matches the nucleotides in order to make the DNA copies 7)After everything has been released into the test tube, place the PCR tube into the thermal cycler. 
 OpenPCR program HEATED LID: 100°C INITIAL STEP: 95°C for 2 minutes NUMBER OF CYCLES: 25 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, andExtend at 72°C for 30 seconds FINAL STEP: 72°C for 2 minutes FINAL HOLD: 4°C 
 
 
 Research and DevelopmentPCR - The Underlying Technology 
 
 What happens to the components (listed above) during each step of thermal cycling? 
 Which base anneals to each base? A to T T to A G to C C to G During which two steps of thermal cycling does base-pairing occur? Explain your answers.
This process occurs during Annealing and Extension, where the base pairs are polymerized and joins with the primer sequences. At these two points of the process, the amount of DNA is doubled and is prepared for the entire process to repeat itself.
 SNP Information & Primer DesignBackground: About the Disease SNP SNP (Single Nucleotide Polymorphism) is the occurance of a nucleotide (adenine, thymine, guanine, or cytosine) change to another nucleotide. An example of this would be if a guanine changing into a thymine. The result could be minimal or could result in a horrific disease, like Alzheimer's or Crohn's disease, to occur in the patient. 
 What is a nucleotide? The structural components, or building blocks, of DNA and RNA. It consists of a base (adenine, thymine, guanine, and cytosine) plus a molecule of sugar and one of phosphoric acid. What is a polymorphism? The variation of a certain gene in a specified population What species is this variation found in? Homo Sapiens What chromosome is the variation located on? 16:89919736 What is listed as the Clinical significance of this SNP? Pathogenic Which gene(s) is this SNP associated with? MC1R What disease is linked to this SNP? Melanoma, Parkinson's, Crohn's What does MC1R stand for? Melanocortin 1 Receptor What is the function of MC1R? Melanocortin receptor activity, Hormone Binding, G-Protein coupled peptide receptor activity Write the first three unique terms you see. What is an allele? A variant form of a gene. The disease-associated allele contains what sequence? CGG->TGG The numerical position of the SNP is: 89919736 Non-disease forward primer: 5'-CAGCATCGTGACCCTGCCGC The numerical position exactly 200 bases to the right of the disease SNPis: 89919936 Non-disease reverse primer: 5'-CTTGTGGAGCCGGGCGATGC Disease forward primer: 5'-CAGCATCGTGACCCTGCCGT Disease reverse primer: 5'-CTTGTGGAGCCGGGCGATGC Why is there no match for the Disease-specific primer we created? There were no matches for the created primer because the specific portion of the DNA that we attempted to replicate could actually result in a replication. That it has no matches also establishes that no other extraneous portions of the DNA are replicated resulting in a originality between the primer and the DNA strand. This is assured by how it will only be replicated to the targeted SNP rather than the extraneous DNA. Results for a) >chr16:89986125+89986344 220bp CAGCATCGTGACCCTGCCGC CTTGTGGAGCCGGGCGATGC CAGCATCGTGACCCTGCCGCgggcgcggcgagccgttgcggccatctggg tggccagtgtcgtcttcagcacgctcttcatcgcctactacgaccacgtg gccgtcctgctgtgcctcgtggtcttcttcctggctatgctggtgctcat ggccgtgctgtacgtccacatgctggcccgggcctgccagcacgcccagg GCATCGCCCGGCTCCACAAG Results for b) No matches to cagcatcgtgaccctgccgt cttgtggagccgggcgatgc in Human Feb. 2009 (GRCh37/hg19) | ||||||||||||||||||||||||||||||||||