BME100 f2015:Group15 8amL4

BME 100 Fall 2015	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Renee Chapman Name: Malaya Prado Name: Tedi Serreti Name: Ibrahim Almuteb Name: student Role(s) Name: student Role(s) LAB 4 WRITE-UP Protocol Materials Lab coat and disposal gloves PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s (http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorless-master-mix-m714-protocol/) DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer A strip of empty PCR tubes Disposable pipette tips: only use each only once. Never re-use disposable pipette tips or samples will be cross-contaminated Cup for discarded tips Micropipettor OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G15 + Positive control none G15 - Negative control none G15 1-1 Patient 1, replicate 1 73968 G15 1-2 Patient 1, replicate 2 73968 G15 1-3 Patient 1, replicate 3 73968 G15 2-1 Patient 2, replicate 1 93754 G15 2-2 Patient 2, replicate 2 93754 G15 2-3 Patient 2, replicate 3 93754 DNA Sample Set-up Procedure Take samples of DNA from patients who have submitted it to be tested for diseases. DNA has to extracted from cells such as hair follicles or skin. Put extracted DNA into a PCR tube Add Primer 1 into same PCR tube and Primer 2 into PCR tube. The primers attach to the parts of the DNA that need to be duplicated. Next add Nucleotides into the PCR tube. These are what create many copies of DNA. Next add DNA polymerase into the PCR tube, which will read the DNA codes and attach the nucleotides. Place PCR tube into a DNA thermal cycler which will heat and cool the tube. Set thermal cycler and the temperature will change from 95 degrees to 50 degrees to 72 degrees (Celsuis) for each cycle. Collect your pure target sequence OpenPCR program Thermal cycling is precisely alternating the heat of a solution or material from a hotter temperature to a lower temperature or from a lower temperature to a hotter temperature at specific times, through a period of time. HEATED LID: 100°C INITIAL STEP: 95°C for 2 minutes NUMBER OF CYCLES: 25 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds FINAL STEP: 72°C for 2 minutes FINAL HOLD: 4°C Research and Development PCR - The Underlying Technology Question 1: For this PCR reaction, DNA is extracted from cells such as hair follicles, skin or saliva. After the DNA is placed in a PCR tube, primers are added to attach to certain sites of the DNA that are wanted to be copied. Nucleotides are then added into the PCR tube to make up the DNA code and will create many duplicates of the DNA. Lastly, the DNA polymerase are then added into the PCR tube and is responsible for translating the DNA code and attaching the matching nucleotides. The Deoxyribonucleotides are used specifically because they can handle the high temperatures that the PCR reaction will create. Question 2: Once the PCR tube goes into the thermal cycler the temperature will increase to 95 degrees Celsius. During this temperature, the DNA's double helix will separate into two single stand of DNA. The temperature then drops to 50 degrees Celsius which is when the primers lock on to the target sites of the DNA before the DNA single strands try to pair up. After this portion of the cycle, the temperature will then increase to 72 degrees Celsius. At this temperature, the DNA polymerase is activated and adds nucleotides to the primers located on the strands. The DNA polymerase continues this process into it gets to the end of the DNA strand. The cycle repeats over and over again until at the final temperature of 4 degrees Celsius is reached and the target sequence has billions of copies. Question 3: Adenine (A) attaches to Thymine (T) and vise versa. The Cytosine (C) attaches to Guanine (G) and vise versa. Question 4: Base pairing happens during the step when the primers and the DNA polymerase become activated. The primers attach to the sites of the DNA before the single strands of the DNA try to pair up. When the DNA polymerase become activated, it adds nucleotides to the primers which will translate the DNA code and match nucleotides together. SNP Information & Primer Design Background: About the Disease SNP A nucleotide is a compound consisting of a nucleoside linked to a phosphate group. Nucleotides form the basic structural unit of nucleic acids in DNA. A polymorphism is a DNA sequence variation occurring commonly within a population in which a single nucleotide in the genome differs between members of a biological species or paired chromosomes. This variation is found in homo sapiens. It is located on chromosome 16.The clinical significance is listed as other. It is associated with the gene MC1R. The disease most comonly associated is melanoma. MC1R stands for melanocortin 1 receptor(alpha melanocyte stimulating hormone receptor). Encodes the receptor protein for melanocyte-stimulating hormone. Is a determining factor in normal human pigment variation. An allele is one or two or more alternative forms of a gene that arise by mutation and are found at the same place on a chromosome. The disease associated allele is the sequence TGG.The position is 89919736. Primer Design and Testing The non-diseased forward primer starting from the five prime is 5'ACAGCATCGTGACCCTGCCGC. The Numerical position is 89919936 The Non-disease reverse primer is CTTGTGGAGCCGGGCGATGC The Disease forward primer is CAGCATCGTGACCCTGCCGT The Disease reverse primer is GTCGTAGCACTGGGACGGCA