Name: Sydney Spicer Roles:Materials and PCR reaction list,SNP and Primer design
Name: Paige Williams Roles:SNP Information & Primer Design
Name: Vishal Giri Roles:Research & Development
Name: Tofi Lautoa Roles:SNP Information & Primer Design
LAB 4 WRITE-UP
Protocol
Materials
Lab coat and disposable gloves
PCR reaction: (8 Tubes) 50 μL each: Mix contains Taq DNA polymerase, MgCl 2, and dNTP’s
DNA/ primer mix: (8 tubes) 5o μL each: Each mix contains a different template DNA. All tubes have the same forward and reverse primer
A strip of empty PCR tubes
Disposable pipette tips: only use each once:
Cup for discarded tips
Micropipettor
OpenPCR machine: Shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G15 +
Positive control
none
G15 -
Negative control
none
G15 1-1
21956, replicate 1
21956
G15 1-2
21956, replicate 2
21956
G15 1-3
21956, replicate 3
21956
G15 2-1
84919, replicate 1
84919
G15 2-2
84919, replicate 2
84919
G15 2-3
84919, replicate 3
84919
DNA Sample Set-up Procedure
First collect 3 replicate DNA samples from 2 different patients, as well as a positive control DNA sample from a patient that tests positive for the disease SNP and a negative control DNA sample from a patient that tests negative for the disease SNP.
The next step is to gather the needed materials for a PCR reaction as seen in the list above. Each PCR reaction mix tube needs to be combined with one DNA/primer mix tube in an empty PCR tube, and this process needs to be repeated for all 8 tubes.
There will now be 8 PCR tubes with a combination of DNA/primer and PCR reaction mix. These 8 PCR tubes need to be placed in the DNA thermal cycler to begin the PCR process.
OpenPCR program
Heated lid has a temperature of 100 degrees Celsius.
Step One: Heat the system to 95 degrees Celsius for two minutes.
Step Two: For a total of 25 cycles, do the following:
Denature the samples at 95 degrees Celsius for a total of 30 seconds per cycle,
Anneal at 57 degrees Celsius for 30 seconds per cycle,
and Extend at 72 degrees Celsius for 30 seconds per cycle.
For the final step, keep the sample at 72 degrees Celsius for two minutes.
After, hold the temperature at 4 degrees Celsius.
Research and Development
PCR - The Underlying Technology
Q1: What is the function of each component of a PCR reaction?
The main components in a PCR reaction are the template dna, primers, taq polymerese, and deoxyribonucleotides. Template DNA is a guide for creating new, identical DNA strands.Once the DNA helix is split, primers attach to a pre-specified section of DNA and act as a signal for Taq Polymerase to complete the copy of the specified section of DNA. Taq Polymerase attach the dNTP's to the strand of DNA that was marked by the primer. Deoxyribonucleotides are the building blocks of the DNA that are used by the taq polymerase to copy the specified strand.
Q2: What happens to the components during each step of thermal cycling?
In step one (95 degrees Celsius for three minutes), the template DNA is heated so that the two strands of the DNA helix are straightened and then the template DNA is denatured.
Next, for each cycle, the original copy and the new copy of the specified strand of DNA are separated by the process of "denaturing." This is done by keeping the sample at 95 degrees Celsius for 30 seconds.
Primers are then activated in the "anneal" step and attach to the section of each strand that they are designated to copy. This occurs by bringing the temperature of the sample down to 57 degrees Celsius for 30 seconds.
At this point, during the "extend" phase, the taq polymerase binds to the primers and copies the previously copied strand of DNA by adding dNTP's. The sample's temperature is raised to 72 degrees Celsius for 30 seconds.
The previous three steps, "denature," "anneal," and "extend," are repeated for a total of 25 cycles.
After the 25 cycles are completed, in the final step, the entire sample of copied DNA strands are left alone to make sure the process is completed and that the sample remains unaffected by outside agents.
Once the process is completed and source of dNTP's has been exhausted, the sample is stored in a colder environment to maintain integrity. The sample is held at 4 degrees Celsius.
Q3: Given the four base nucleotides (A, T, C, and G), which base anneals to which?
The four base nucleotides are Adenine, Thymine, Cytosine, and Guanine. All Thymine nucleotides can only bind with Adenine. The same goes backwards to Adenine matching only with Thymine. Cytosine and Guanine are the other two base nucleotides they only bind to each other. Cytosine with Guanine and Guanine with Cytosin.
Q4: For which of the thermal cycles does base-pairing happen?
During the anneal and extend cycles, the base-pairing occurs. This is because the taq polymerase is attached to the primer during the anneal step and begins binding dNTP's to the corresponding base pairs during the extend step of the cycle.
Original Diagram of PCR:
This image was original and created by Elijah using powerpoint
SNP Information & Primer Design
Background: About the Disease SNP
A nucleotide is the basic building block of a DNA molecule because it is a compound containing nucleosides connected to a phosphate group. A polymorphism is when a single base pair changes in a DNA sequence, but polymorphism can also involve large portions of DNA sequences that have multiple altered base pairs. The variation of interest occurs in homo sapiens, more commonly known as humans, and the variation occurs on the 16:89919736 chromosome and is associated with the MC1R gene. Parkinson's disease is associated with the SNP involving the MC1R gene, and the SNP of interest has a pathogenic clinical significance.
MC1R stands for melanocortin 1 receptor, and this is the gene associated with the SNP of interest. The function of the MC1R gene includes G-protein coupled peptide receptor activity, hormone binding, and melanocortin receptor activity. An allele is an alternative form of a gene that results from a mutation and is found in the same place on the chromosome. The disease-associated allele contains a TGG sequence while the normal gene has a sequence of CGG. The numerical position of the SNP is 89919736.The non-disease forward primer has the following DNA sequence: CAGCATCGTGACCCTGCCGC. The numerical position exactly 200 bases to the right of the disease SNP is 89919936. The non-disease reverse primer is CTTGTGGAGCCGGGCGATGC. The disease SNP-specific forward primer has the DNA sequence of CAGCATCGTGACCCTGCCGT and the disease SNP-specific reverse primer has the DNA sequence of CTTGTGGAGCCGGGCGATGC. The non-disease primers were validated using the USC In-Silico PCR and the results can be seen below. in Figure 1.
Primer Design and Testing
Both non-disease primers were validated using the UCSC In-Silico PCR program and the results of the forward and reverse non-disease primers can be seen in Figure 1 below. The non-disease primers are valid because a 220bp sequence on the MC1R gene was the result of testing the primers. Both of the disease SNP-specific primers were also validated using the UCSC In-Silico PCR and were found to be valid because the program found no matches for the primers. The results can be seen in Figure 2 below.