|
OUR TEAM
LAB 4 WRITE-UP
Protocol
Materials
- Lab coat and disposable gloves
- PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2
, and dNTP’s
(http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorle
ss-master-mix-m714-protocol/)
- DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes
have the same forward primer and reverse primer
- A strip of empty PCR tubes
- Disposable pipette tips: only use each only once. Never re-use disposable pipette tips or
samples will be cross-contaminated
- Cup for discarded tips
- Micropipettor
- OpenPCR machine: shared by two groups
PCR Reaction Sample List
| Tube Label |
PCR Reaction Sample |
Patient ID
|
| G12 + |
Positive control |
none
|
| G12 - |
Negative control |
none
|
| G12 1-1 |
32901, replicate 1 |
|
| G12 1-2 |
32901, replicate 2 |
|
| G12 1-3 |
32901, replicate 3 |
|
| G12 2-1 |
69184, replicate 1 |
|
| G12 2-2 |
32901, replicate 2 |
|
| G12 2-3 |
32901, replicate 3 |
|
DNA Sample Set-up Procedure
- Step 1: Heat the Lid to 100°C Centigrade
- Step 2: Place the sample PCR reaction on to the lid at 95°C and hold there for 2 minutes
- Step 3: After 2 minutes, hold the sample PCR reaction over the lid at 95°C for 30 seconds
- Step 4: Anneal the sample PCR reaction at 57°C for 30 seconds
- Step 5: Extend the sample PCR reaction at 72°C for 30 seconds
- Step 6: Repeat steps 3 - 5, 25 times for each sample PCR reaction
- Step 7: Finally hold the sample PCR reaction at 72°C for 2 minutes
- Step 8: After 2 minutes at 72°C, place sample PCR reaction tube in to the thermal cylinder at 4°C
OpenPCR program
Error creating thumbnail: File missing
Research and Development
PCR - The Underlying Technology
- 1. What is the function of each component of a PCR reaction?
| Template DNA: |
The template DNA is the sequence of DNA to be copied during PCR.
|
| Primers: |
Primers match the template DNA and attach to the separated top and bottom strands through complementary base pairing. They allow DNA polymerase to attach and begin to replicate the template sequence.
|
| Taq Polymerase: |
Taq Polymerase is a complex of proteins that adds nucleotides to the DNA sequence being copied, beginning at a primer base-paired with a longer piece of DNA.
|
| Deoxyribonucleotides (dNTP's): |
Taq Polymerase attaches dNTPs, which are broken into nucleotides, to the DNA strand being copied through complementary base pairing.
|
- 2. What happens to the components (listed above) during each step of thermal cycling?
| INITIAL STEP: 95°C for 3 minutes: |
DNA, including the target sequence, separates for the first time, creating 2 separate single-stranded DNA molecules.
|
| Denature at 95°C for 30 seconds: |
DNA, including the target sequence, separates again after the first complete cycle, creating additional single-stranded DNA molecules.
|
| Anneal at 57°C for 30 seconds: |
Primers attach to corresponding base pairs of the target sequence.
|
| Extend at 72°C for 30 seconds: |
Taq Polymerase activates, locates primers attached to single strands of DNA.
|
| FINAL STEP: 72°C for 3 minutes: |
Taq Polymerase runs down the DNA strand and adds complementary dNTPs to make a double-stranded piece of DNA.
|
| FINAL HOLD: 4°C: |
The copies of the target sequence are preserved for later analysis.
|
- 3. DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G. Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to each base listed below?
| Adenine (A): |
Thymine (T) |
Thymine (T): |
Adenine (A) |
Cytosine (C): |
Guanine (G) |
Guanine (G): |
Cytosine (C)
|
- 4. During which two steps of thermal cycling does base-pairing occur? Explain your answers.
- Base-pairing occurs during annealing and extension. During extension, Taq Polymerase attaches dNTPs to their complementary bases on the strand being copied. During annealing, primers attach only to the complementary bases on the target sequence.
Part 1: NCBI Database
| What is a nucleotide?
|
A compound consisting of a nucleoside linked to a phosphate group. Nucleotides form the basic structural unit of nucleic acids such as DNA and RNA. The nucleotide bases are adenine, guanine, thymine, cytosine and uracil. A and G are the purines, double nitrogen containing rings, and T, C and U are pyrimidines, single nitrogen containing rings.
|
| What is a polymorphism?
|
The occurrence of a number of alternative forms within a section of a nucleic acid or protein molecule.
|
| What species is this variation found in? (latin name) |
Homo Sapiens
|
| What chromosome is the variation located on? |
16:89919736
|
| What is listed as the Clinical significance of this SNP? |
It is pathogenic
|
| Which gene(s) is this SNP associated with? |
MC1R
|
| Click the PubMed link to view summaries of research associated with the SNP. What disease is linked to this SNP? |
Parkinson's Disease and Melanoma
|
Part 2: Finding DNA Sequence of SNP
| What does M1CR Stand for? |
melanocortin 1 receptor
|
| What is the function of MC1R? To find out, click the MC1Rlink. Look for “Gene ontology” in the right hand list and click it. Write the first three unique terms you see. |
The function of MC1R is hormone binding, melanocortin receptor activity, and ubiquitin protein ligase binding
|
| What is an allele? |
A variant form of a gene. Some genes take different forms which are located at the same position or genetic locus on a chromosome.
|
| The disease- associated allele contains what sequence? |
CGG --> TGG
|
| The numerical position of the SNP is: |
88919736
|
Part 3:
| Non-disease forward primer: |
5'- CAGCATCGTGACCCTGCCGC
|
| 200 BASES TO THE RIGHT |
88919936
|
| Non-disease reverse primer |
CTTGTGGAGCCGGGCGATGC
|
| Disease forward primer |
CAGCATCGTGACCCTGCCGT
|
| Disease reverse primer |
CTTGTGGAGCCGGGCGATGC
|
|