|
OUR TEAM
LAB 4 WRITE-UP
Protocol
Materials
- Lab Coat and Disposable Gloves
- PCR reaction mix, 8 tubes, 50uL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP's
- DNA/primer mix, 8 tubes, 50uL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
- A strip of empty PCR tubes
- Disposable pipette tips: only use each only once. Never re-use disposable pipette tips or samples will be cross-contaminated
- Cup for discard tips
- Micropipettor
- OpenPCR machine: shared by two groups
PCR Reaction Sample List
| Tube Label |
PCR Reaction Sample |
Patient ID
|
| G11 + |
Positive control |
none
|
| G11 - |
Negative control |
none
|
| G11 1-1 |
Patient 1, replicate 1 |
79685
|
| G11 1-2 |
Patient 1, replicate 2 |
79685
|
| G11 1-3 |
Patient 1, replicate 3 |
79685
|
| G11 2-1 |
Patient 2, replicate 1 |
90772
|
| G11 2-2 |
Patient 2, replicate 2 |
90772
|
| G11 2-3 |
Patient 2, replicate 3 |
90772
|
DNA Sample Set-up Procedure
- Step 1: Gather all materials listed above and make sure to wear safety goggles and lab coat
- Step 2: To start this experiment DNA must be extracted from cells that can come from hair follicles, blood sample, skin, saliva, etc.
- Step 3: Take the extracted DNA and place it into specially labeled PCR tubes
- Step 4: Add primer 1 to the same PCR tube as the DNA
- Step 5: Add primer 2 to the same PCR tube
- Step 6: Add nucleotides to the same PCR tube
- Step 7: Add DNA Polymerase to the same PCR tube
- Step 8: Place PCR tube into Thermal Cycler
OpenPCR program
- Heated Lid: 100*C
- Initial Step: 95*C for 2 minutes
- Number of Cycles: 25
Denature at 95*C for 30 seconds, Anneal at 57*C for 30 seconds and
Extend at 72*C for 30 seconds
- Final Step: 72*C for two minutes
- Final Hold: 4*C
A Thermal Cycling Program is a machine that is used to amplify segments of DNA using the polymerase chain reaction. This machine can control temperature changes which will be used to make reactions occur within the DNA allowing it to split, primers to attach, polymerase to attach and then the DNA can replicate over and over again with each temperature change.
Error creating thumbnail: File missing
Research and Development
PCR - The Underlying Technology
Q1: What is the function of each component of a PCR reaction?
The template DNA is the DNA that is extracted from a cell in order to begin the experiment. A specific DNA sequence on the template DNA is then chosen for the primers to target. With this template DNA, the PCR process can then take place to create 10^25-10^42 copies.
Primers are custom built strands of DNA and are necessary in the experiment because DNA polymerase can’t attach to a random place and start copying, it needs an existing piece of DNA. Primers attack to sites on the DNA strands that are at either end of the segment you want to copy. They are powerful tools for copying specific DNA sequences since the possibility of them targeting the wrong site is very low.
This is an enzyme that copies DNA. It is a bacterium that has adapted to the hot environment of hot springs, so the enzyme doesn’t break down at the high temperatures during the process of PCR.
These are the monomers of DNA that bind to the corresponding monomer on each strand of DNA. These hydrogen bonds are broken up when the DNA is heated up to 95°C, creating two separate strands of the DNA. The specific site of the template DNA that is targeted is determined by the sequence of Deoxyribonucleotides.
Q2. What happens to the components (listed above) during each step of thermal cycling?
Initially the little tubes are heated up to 95°C for 3 minutes in preparation for the cycle to begin. It is prepping for the hydrogen bonds to split and for the template DNA to split.
At this point, the template DNA is denatured or split into two identical strands over 30 seconds, one with 5’ at one end and 3’ on the other. This makes it possible for the primers to target targeted DNA pieces that are to be replicated through the PCR process.
When the thermal cycler cools down to 57°C for 30 seconds, the strands of DNA from the template DNA are annealed or attempt to pair up but due to the overwhelming number of primers in the tube, the primers lock onto the target before they can pair back up.
At 72°C, the DNA polymerase activates and locates the primer attached to a single DNA strand.
Finally it adds the complementary nucleotides onto the strand. This process continues for 3 minutes until the polymerase reaches the end of the strand and falls off. What is left is a replicated portion of the template DNA that was targeted in the beginning of the experiment.
The final hold is the state where the target sequence of DNA is present in multiple numbers at 4°C. This is also where the experiment will then start over again to create more copies of the target sequence, beginning with the initial step of heating it to 95°C.
Q3: Which base anneals to which?
Thymine (T) anneals to adenine (A) and vice versa. Guanine (G) anneals to cytosine (C) and vice versa.
A - T
T- A
C - G
G - C
Q4: During which two steps of thermal cycling does base-pairing occur?
Base pairing occurs during the process of annealing in which the temperature of the system is lowered to 57°C to allow short DNA primers to be attached to DNA strands that have been separated to act as starting positions for replication and then during extending in which the temperature of the system is raised to 72°C to permit Taq polymerases to attach to the primer to match bases with their pairs and extend the primers to form nucleotide strands of desired target sequences of DNA for amplification, respectively.
Q6: What does MC1R stand for?
MC1R, also known as Melanocortin 1 Receptor (Alpha Melanocyte Stimulating Hormone Receptor), controls MelanoGenesis.
What is the function of MC1R?
MC1R provides instructions for making a protein called the melanocortin 1 receptor. This receptor controls melatonin pigmentation. This pigment is known as melanin.
- G-protein coupled peptide receptor activity
- hormone binding
- melanocortin receptor activity
Q7: What is an allele?
An allele is a variant form of a gene. The disease-associated allele contains the sequence TGG.
Background: About the Disease SNP
SNP is defined as single nucleotide polymorphisms. This is a common type of genetic variation among people where each SNP represents a difference in a DNA block. This difference is usually one nucleotide that may change when looking at two strands of DNA from the same regions of two different people. Each SNP can have four versions including: A, C, G, and T. But not all single nucleotide changes are SNPs, there must be two or more versions of a sequence present in at least one percent of the general population. It is estimated that there are over ten million SNP's in a person's DNA.
Primer Design and Testing
A nucleotide is a structural building block of DNA, it consists of a base, a molecule of sugar, and one phosphoric acid. Polymorphism is the presence of a certain genetic variation in a population.
The species in the variation rs1805008 is Homo sapiens. This variation is on the 16:89919736 chromosome. The clinical significance of this SNP is pathogenic. This SNP is associated with the MC1R gene. Some diseases linked to this SNP are melanoma, Clear Cell Renal Cell Carcinoma, and other skin pigmentation diseases.
The numerical position of this SNP is 89919736
The Non-Disease Forward Primer is CAGCATCGTACCCTGCCGC
The Non-Disease reverse primer location is 89919936
The Non-Disease revers primer is CTTGTGGAGCCGGGCGATCC
The disease forward primer is CAGCATCGTACCCTGCCGG
The disease reverse primer is CTTGTGGAGCCGGGCGATCC
|