|
OUR TEAM
LAB 4 WRITE-UP
Protocol
Materials
- Lab coat and disposable gloves
- PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s
- DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
- A strip of empty PCR tubes
- Disposable pipette tips: only use each only once. Never re-use disposable pipette tips or samples will be cross-contaminated
- Cup for discarded tips
- Micropipettor
- OpenPCR machine: shared by two groups
PCR Reaction Sample List
| Tube Label |
PCR Reaction Sample |
Patient ID
|
| G10 + |
Positive control |
none
|
| G10 - |
Negative control |
none
|
| G10 1-1 |
Patient 1, replicate 1 |
54926
|
| G10 1-2 |
Patient 1, replicate 2 |
54926
|
| G10 1-3 |
Patient 1, replicate 3 |
54926
|
| G10 2-1 |
Patient 2, replicate 1 |
57766
|
| G10 2-2 |
Patient 2, replicate 2 |
57766
|
| G10 2-3 |
Patient 2, replicate 3 |
57766
|
DNA Sample Set-up Procedure
- Pipette a sample of pure DNA into the PCR tube.
- Add the PCR mix, which contains Taq DNA polymerase, MgCl2, and dNTP’s.
- Place the PCR tube into a thermal cycler.
OpenPCR program
- The DNA is placed into the thermal cycling machine.
- The initial temperature is set to 95°C. At this temperature, the DNA denatures meaning that the double stranded DNA begins to break apart into small single strands. The temperature is kept at 95°C for 2 minutes in order to ensure that the DNA is successfully denatured.
- The DNA then begins to cycle. The DNA begins at 95°C to denature. The DNA is then cooled to 57°C where the primers bind to the complementary sequence in the DNA template. The PCR machine then raises to 72°C where the sticky ends of the DNA strands are completed using the dNTPs and TAQ Polymerase. This process is completed a number of times in order to synthesize the correct portion of DNA.
- The final step is to hold 72°C for 2 minutes to allow the DNA to recover from PCR. Any remaining single stranded DNA is completed with TAQ Polymerase. The resulting DNA should be the desired length and have the desired function.
- The purpose of the final hold at 4°C is to prime the PCR machine for the next round of PCR.
Research and Development
PCR - The Underlying Technology
During the process of PCR, there are four main components that are necessary for the process to work: template DNA, primers, Taq polymerase, and deoxyribonucleotides. The template DNA is the original strand of DNA which contains the target sequence where the primer binds and builds the new strand of DNA. The primer is a short piece of DNA that is complimentary to the target sequence (has the complimenting bases of the template DNA). The location of the primer is where the DNA polymerase begins synthesizing the new DNA strand. Taq Polymerase is an enzyme that can survive at very high temperatures, and catalyzes the DNA synthesis. The deoxyribonucleotides, also known as dNTP's, are the single base units of the DNA being paired (A, T, C, G).
PCR is a repetition of three steps until the desired amplification is achieved: denaturing, annealing, extending. At first, the DNA is held at 95 degrees Celsius for three minutes, where the template DNA begins to denature. During denaturing, the DNA template begins to separate because the hydrogen bonds are breaking due to the high temperature, and the single strands of DNA are formed. After the denaturing of the DNA, the temperature is lowered to 57 degrees Celsius. At this temperature, the annealing process begins. Since the temperature is lowered to a cooled temperature, the primers are able to bind to the complementary DNA sequence in the template. Once the primers bind to the DNA, the temperature is then raised once again to 72 degrees Celsius. At this temperature, the DNA polymerase is able to act by adding the proper nucleotides onto the primer, and, therefore, extending the primer. The target DNA is used as the template during this process. The four bases, as previously mentioned, are A, T, C, and G. The proper base pairs for these bases are as follows: Adenine(A)--Thymine(T), Thymine(T)--Adenine(A), Cytosine(C)--Guanine(G), Guanine(G)--Cytosine(C).
Base pairing occurs at two different steps of thermal cycling. First, base pairing occurs at annealing, where the primer binds to the DNA template, using base pairs to bind properly. Base pairing also occurs at extending, where the DNA polymerase adds nucleotides onto the primer, complementing the bases that are present on the target DNA.
Error creating thumbnail: File missing
Source: https://en.wikipedia.org/wiki/Polymerase_chain_reaction#/media/File:Polymerase_chain_reaction.svg
Background: About the Disease SNP
Single nucleotide polymorphism (SNP) is a when a mutation occurs in the DNA sequence that causes a variation in a single base pairing. The rs1805008 variation of SNP is typically found in humans (homo sapiens) on chromosome 16 at the 89919736th base pair. This variation affects the the Melanocortin 1 Receptor (MC1R) gene. Normally, the MC1R gene acts as a G-protein coupled peptide receptor, hormone binder, and melanocortin receptor. However when SNP occurs, the allele CGG is changed to TGG on the gene, which mainly results in the skin cancer melanoma, which can also lead to Parkinson’s disease and multiple sclerosis.
Primer Design and Testing
Our non-disease forward primer was CAGCATCGTGACCCTGCCGC and the non-disease reverse primer was CTTGTGGAGCCGGGCGATGC. As for the disease forward primer, it was CAGCATCGTGACCCTGCCGT and the disease reverse primer was CTTGTGGAGCCGGGCGATGC. It should be noted that the only difference between these primers is the very last nucleotide in the forward primer, where the C in the non-disease primer is replaced with a T in the disease primer. Everything else stays the same in order to make sure that this single mutation is the only one captured with these primers. When the non-disease primers were tested in the UCSC In-Silico PCR website, it resulted in a 220 base pair sequence from chromosome 16 (Figure 1). However, when the disease primers were tested in the same website, there were no sequences that came up as a match. This is because SNP is a mutation, and hence this sequence is not typically found in the normal chromosome.
Figure 1
|
BME 100 Fall 2015
