BE.180:Assignment1/Promoter

From OpenWetWare
Jump to: navigation, search


taatacgactcactatagggaga

consensus T7 RNA polymerase promoter