Arking:JCATutorialIntro9

Home Page

For these tutorials, you will need a sequence editor such as ApE, Benchling, or SnapGene. ApE (A Plasmid Editor) is a free software tool for viewing, annotating, and editing sequence files. To use it, you will first download and install the program, then you can update the features and enzymes to include those discussed in the tutorials.

Install ApE

Download and install ApE from the official website: ApE Download Page

Update Features and Enzymes in ApE

To ensure ApE recognizes the latest feature annotations and enzyme files, follow these steps:

Step 1: Set Up a Storage Folder

• Create an empty folder on your computer to store the updated feature list.

Step 2: Configure ApE Settings

1. Open ApE and navigate to ApE > Settings...
2. Click the Files tab.
3. Under Default Feature Directory, click Move Directory, select the newly created folder, and click OK.
4. Repeat this for Default Enzymes Directory.
5. Click OK to close the settings window. ApE will generate default versions of these files in the folder.

Step 3: Download and Replace Feature Files

• Download and unzip the updated files:

 Download Here  

Step 4: Load the Updated Feature Library

1. In ApE, go to Features > Open Feature Library...
2. Navigate to default_features.txt in the unzipped folder and select it.
3. Click OK to confirm and exit.

ApE is now updated with the latest feature annotations!

Test the Update

The default feature file includes common plasmid elements like origins of replication and antibiotic resistance genes. The updated file includes additional features relevant to the tutorials and TPcon6 project.

Try It Out

Copy and paste the following sequence into ApE:

GAATTCGAGGAGTCCTGGGTTCACTAGAGTTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCTACTAGAGAAAGTTAGTATTTCTCCTCGGATCC

Your screen should highlight: - Green: EcoRI, BseRI, and BamHI restriction sites - Yellow: Pcon promoter

Now, press Cmd + K (Mac) or Ctrl + K (Windows) to search for recognized elements. If the update was successful, your ApE window should match the expected output shown in the tutorial.