User:Torsten Waldminghaus/qPCR-Primers

From OpenWetWare
< User:Torsten Waldminghaus
Revision as of 02:13, 16 December 2008 by Torsten Waldminghaus (talk | contribs) (New page: {| border="3" ! Name !! Sequence !! Characteristics !! |- ! uvrDfw | AGTTCCCGCAGGTGTTTATC | qPCR for uvrD-region with no GATC-sites (Region B from <cite>Yamazoe-2005</cite>) |- ! uvrDrv ...)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
Name Sequence Characteristics
uvrDfw AGTTCCCGCAGGTGTTTATC qPCR for uvrD-region with no GATC-sites (Region B from [1])
uvrDrv GTCAGCGTCAGTTTCTGCAT qPCR for uvrD-region with no GATC-sites (Region B from [1])
uvrDprobe AGACGCCCGCCTTCATCCAG HPLC-pure 5'Fam - 3'Tamra qPCR for uvrD-region with no GATC-sites (Region B from Yamazoe et al., 200


  1. Yamazoe M, Adachi S, Kanaya S, Ohsumi K, and Hiraga S. Sequential binding of SeqA protein to nascent DNA segments at replication forks in synchronized cultures of Escherichia coli. Mol Microbiol. 2005 Jan;55(1):289-98. DOI:10.1111/j.1365-2958.2004.04389.x | PubMed ID:15612935 | HubMed [Yamazoe-2005]