User:Torsten Waldminghaus/ds-oligos

From OpenWetWare
< User:Torsten Waldminghaus
Revision as of 06:17, 24 August 2011 by Torsten Waldminghaus (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
  • All oligos are two annealed strands and are in concentrations of 100pmol/μL
Name Sequence 1 Sequence 2 Characteristics Oligo number
half-linker A GGCCGCGATATCTTATCCAACxT P-GTTGGATAAGATATCGC bold=biotin label; x=Phosphorothioate linkage; P=phosphate 1
half-linker B GGCCGCGATATACATTCCAACxT P-GTTGGAATGTATATCGC bold=biotin label; x=Phosphorothioate linkage; P=phosphate 2