Difference between revisions of "IGEM:Imperial/2010/Output module"

From OpenWetWare
Jump to: navigation, search
(N- or C- terminus of C23O)
(/* C23O biobrick)
Line 195: Line 195:
The C-terminus, on the other hand, is less accessible, but fusing GST there could prevent entry of the substrate into the funnel that runs through the enzyme. It is also closer to the oligomerisation domain and so fusing GST here is more likely to prevent oligomerisation.
The C-terminus, on the other hand, is less accessible, but fusing GST there could prevent entry of the substrate into the funnel that runs through the enzyme. It is also closer to the oligomerisation domain and so fusing GST here is more likely to prevent oligomerisation.
The C23O gene is already part of a BioBrick (Part:BBa_K118021).
==James- some suggested papers:==
==James- some suggested papers:==

Revision as of 08:29, 3 August 2010

Effector 1 (Protease) Effector 2 (Dye,Enz) Pigment biosynthetic pathways
transcr sigma 54 2 colourless Bilins
Activation (phosphorylation) Enz-in-pathway
  • short pathways
  • ensure - colourless -> colour
  • short pathways
  • ensure - colourless -> colour
Target proteases to use
  • not many AA
  • non-toxic
  • can work in E.Coli
  • quantize speed, efficiency
Protein scaffold Fret pairs as back up for effectors
2C DNA binding prot release

This review article has some useful information on FRET.

Our autoinhibitory coiled-coil output constructs

Taken and adapted from the JACS article 'An Autoinhibited Coiled-Coil Design Strategy for Split-Protein Protease Sensors' ref

The construct design is of the order:

A’-TEV-B-NFluc Cfluc-A-TEV-B‘2A

Where in our case NFluc and CFluc will be NBlactamase CBlactamase//split eGFP and split TEV itself. The 2A refers to a mutated variation of the original coil sequence (AQLKKKLQANKKELAQLKWKLQALKKKLAQ)which produced a better coil activity.


gcgcagctggaaaaagaactgcaggcgctggaaaaaaaactggcgcagctggaatgggaa aaccaggcgctggaaaaagaactggcgcag


gcgcaggcgaaaaaaaaagcgcaggcgaacaaaaaagaactggcgcagctgaaatggaaa ctgcaggcgctgaaaaaaaaactggcgcag

Tobacco etch virus (TEV) protease-cleavable linker (GGGGENLYFQGGKLGGGG)was used.

ggcggcggcggcgaaaacctgtattttcagggcggcaaactgggcggcggcggc LINKER

Overall sequence for Coiled-coil construct


ggcggcggcagcggcggcggcagcggcggcggcagcgcgcagctggaaaaagaactgcaggcgctggaaaaaaaactggcgcagctggaatgggaa aaccaggcgctggaaaaagaactggcgcagggcggcggcggcgaaaacctgtattttcag ggcggcaaactgggcggcggcggcgcgcaggcgaaaaaaaaagcgcaggcgaacaaaaaa gaactggcgcagctgaaatggaaactgcaggcgctgaaaaaaaaactggcgcag


gcgcagctggaaaaagaactgcaggcgctggaaaaaaaactggcgcagctggaatgggaa aaccaggcgctggaaaaagaactggcgcagggcggcggcggcgaaaacctgtattttcag ggcggcaaactgggcggcggcggcgcgcagctgaaaaaaaaactgcaggcgaacaaaaaa gaactggcgcagctgaaatggaaactgcaggcgctgaaaaaaaaactggcgcagggcggcggcagcggcggcggcagcggcggcggcagc

(GGGS)3 is the flexible linker between the split protease/enzyme and the coil!!

Beta-Lactamase construct

NβLac-A-TEV-B’4A βLactamase (26-196)(Glu) TEV B-CβLac βLactamase (Leu)(198-290)

LacB from pQE32 plasmid [[1]]

Showing sequences for the B-Lactamase, the sequences are split into the two halves with the gap in the middle.




Nucleotide atgagcattcagcattttcgcgtggcgctgattccgttttttgcggcgttttgcctgccggtgtttgcgcatccggaaaccctggtgaaagtgaaagatgcggaagatcagctgggcgcgcgcgtgggctatattgaactggatctgaacagcggcaaaattctggaaagctttcgcccggaagaacgctttccgatgatgagcacctttaaagtgctgctgtgcggcgcggtgctgagccgcattgatgcgggccaggaacagctgggccgccgcattcattatagccagaacgatctggtggaatatagcccggtgaccgaaaaacatctgaccgatggcatgaccgtgcgcgaactgtgcagcgcggcgattaccatgagcgataacaccgcggcgaacctgctgctgaccaccattggcggcccgaaagaactgaccgcgtttctgcataacatgggcgatcatgtgacccgcctggatcgctgggaaccggaactgaacgaagcgattccgaacgatgaacgcgataccaccatgccggtggcgatggcgaccaccctgcgcaaactgctgaccggc



fluorocilin green (Invitrogen) was used as the fluorescing substrate.

Split luciferase

entire seq:

Luciferase [Photinus pyralis] GenBank: AAA29795.1

can be obtained from Promega as a reporter plasmid pGL3


Firefly Luciferase(2-416) Firefly Luciferase( 398-550)

N-FLUC protein daknikkgpapfypledgtageqlhkamkryalvpgtiaftdahievnityaeyfemsvrlaeamkryglntnhrivvcsenslqffmpvlgalfigvavapandiynerellnsmnisqptvvfvskkglqkilnvqkklpiiqkiiimdsktdyqgfqsmytfvtshlppgfneydfvpesfdrdktialimnssgstglpkgvalphrtacvrfshardpifgnqiipdtailsvvpfhhgfgmfttlgylicgfrvvlmyrfeeelflrslqdykiqsallvptlfsffakstlidkydlsnlheiasggaplskevgeavakrfhlpgirqgygltettsailitpegddkpgavgkvvpffeakvvdldtgktlgvnqrgelcvrgpmimsgyvnnpeatnalidkdg

Nucleotide gatgcgaaaaacattaaaaaaggcccggcgccgttttatccgctggaagatggcaccgcgggcgaacagctgcataaagcgatgaaacgctatgcgctggtgccgggcaccattgcgtttaccgatgcgcatattgaagtgaacattacctatgcggaatattttgaaatgagcgtgcgcctggcggaagcgatgaaacgctatggcctgaacaccaaccatcgcattgtggtgtgcagcgaaaacagcctgcagttttttatgccggtgctgggcgcgctgtttattggcgtggcggtggcgccggcgaacgatatttataacgaacgcgaactgctgaacagcatgaacattagccagccgaccgtggtgtttgtgagcaaaaaaggcctgcagaaaattctgaacgtgcagaaaaaactgccgattattcagaaaattattattatggatagcaaaaccgattatcagggctttcagagcatgtatacctttgtgaccagccatctgccgccgggctttaacgaatatgattttgtgccggaaagctttgatcgcgataaaaccattgcgctgattatgaacagcagcggcagcaccggcctgccgaaaggcgtggcgctgccgcatcgcaccgcgtgcgtgcgctttagccatgcgcgcgatccgatttttggcaaccagattattccggataccgcgattctgagcgtggtgccgtttcatcatggctttggcatgtttaccaccctgggctatctgatttgcggctttcgcgtggtgctgatgtatcgctttgaagaagaactgtttctgcgcagcctgcaggattataaaattcagagcgcgctgctggtgccgaccctgtttagcttttttgcgaaaagcaccctgattgataaatatgatctgagcaacctgcatgaaattgcgagcggcggcgcgccgctgagcaaagaagtgggcgaagcggtggcgaaacgctttcatctgccgggcattcgccagggctatggcctgaccgaaaccaccagcgcgattctgattaccccggaaggcgatgataaaccgggcgcggtgggcaaagtggtgccgttttttgaagcgaaagtggtggatctggataccggcaaaaccctgggcgtgaaccagcgcggcgaactgtgcgtgcgcggcccgatgattatgagcggctatgtgaacaacccggaagcgaccaacgcgctgattgataaagatggc

C-FLUC Protein msgyvnnpeatnalidkdgwlhsgdiaywdedehffivdrlkslikykgyqvapaelesillqhpnifdagvaglpdddagelpaavvvlehgktmtekeivdyvasqvttakklrggvvfvdevpkgltgkldarkireilikakkggkskl

Nucleotide atgagcggctatgtgaacaacccggaagcgaccaacgcgctgattgataaagatggctggctgcatagcggcgatattgcgtattgggatgaagatgaacatttttttattgtggatcgcctgaaaagcctgattaaatataaaggctatcaggtggcgccggcggaactggaaagcattctgctgcagcatccgaacatttttgatgcgggcgtggcgggcctgccggatgatgatgcgggcgaactgccggcggcggtggtggtgctggaacatggcaaaaccatgaccgaaaaagaaattgtggattatgtggcgagccaggtgaccaccgcgaaaaaactgcgcggcggcgtggtgtttgtggatgaagtgccgaaaggcctgaccggcaaactggatgcgcgcaaaattcgcgaaattctgattaaagcgaaaaaaggcggcaaaagcaaactg

Superfolder split GFP

NOTE readily self assembles as does split Beta-galactosidase

'One fragment of the split GFP contains the first 214 residues of the exceptionally stable, fast-folding ‘‘superfolder’’ GFP protein (Pedelacq et al., 2006), further evolved to be stable as a protein fragment. This fragment includes ten of the eleven strands of the beta-barrel structure of GFP and will be called spGFP1-10. The second split-GFP fragment consists of just 16 residues, 215– 230, which make up the 11th strand of the GFP b-barrel. This second fragment, spGFP11, acts as a small protein tag that can be inserted into many different proteins without affecting their solubility' ref

Amino acid and sequence of the GFP 11 cassette:






Re-confirmed sequence for S219D TEV construct


Nucleotide: ggccgcagcctgtttaaaggcccgcgcgattataacccgattagcagcaccatttgccatctgaccaacgaaagcgatggccataccaccagcctgtatggcattggctttggcccgtttattattaccaacaaacatctgtttcgccgcaacaacggcaccctgctggtgcagagcctgcatggcgtgtttaaagtgaaaaacaccaccaccctgcagcagcatctgattgatggccgcgatatgattattattcgcatgccgaaagattttccgccgtttccgcagaaactgaaatttcgcgaaccgcagcgcgaagaacgcatttgcctggtgaccaccaactttcagaccaaaagcatgagcagcatggtgagcgataccagctgcacctttccgagcagcgatggcattttttggaaacattggattcagaccaaagatggccagtgcggcagcccgctggtgagcacccgcgatggctttattgtgggcattcatagcgcgagcaactttaccaacaccaacaactattttaccagcgtgccgaaaaactttatggaactgctgaccaaccaggaagcgcagcagtgggtgagcggctggcgcctgaacgcggatagcgtgctgtggggcggccataaagtgtttatggataaaccggaagaaccgtttcagccggtgaaagaagcgacccagctgatgaac


Catechol 2,3-dioxygenase (also known as C23O or MPC) catalyses the conversion of a colourless substrate (catechol or substituted catechols) into a bright yellow product (2-hydroxymuconic semialdehyde) within seconds of substrate addition.

C23O is a homotetramer and its crystal structure has been solved. See [Kita et al] or use the accession code 1mpy.

C23O has also been expressed successfully in B. subtilis by [Zukowski et al].

We would make a fusion protein by adding, for example, GST to either the C- or N- terminus. This would hopefully prevent oligomerisation until the TEV protease is activated. TEV would specifically cleave the linker between GST and C23O, resulting in C23O monomers that are capable of oligomerising. Homotetramers would then be active and could catalyse the chromogenic reaction.

The N-terminus could be favoured because it seems to be more accessible to the protease as it is on the surface of the monomer. However, it is further away from the oligomerisation interfaces and so might not actually prevent oligomerisation.

The C-terminus, on the other hand, is less accessible, but fusing GST there could prevent entry of the substrate into the funnel that runs through the enzyme. It is also closer to the oligomerisation domain and so fusing GST here is more likely to prevent oligomerisation.

The C23O gene is already part of a BioBrick (Part:BBa_K118021).

James- some suggested papers:

  1. Kerppola TK. Complementary methods for studies of protein interactions in living cells. Nat Methods. 2006 Dec;3(12):969-71. DOI:10.1038/nmeth1206-969 | PubMed ID:17117150 | HubMed [1]
  2. Wehr MC, Laage R, Bolz U, Fischer TM, Grünewald S, Scheek S, Bach A, Nave KA, and Rossner MJ. Monitoring regulated protein-protein interactions using split TEV. Nat Methods. 2006 Dec;3(12):985-93. DOI:10.1038/nmeth967 | PubMed ID:17072307 | HubMed [2]
All Medline abstracts: PubMed | HubMed

GFP as output