Biomod/2012/UTokyo/UT-Komaba/Experiment/DNA Tablet
<html>
<style type="text/css"> <!--
- column-one {display:none; width:0px;}
- column-content {margin: 0;}
.container{background-color: #ffffff; margin-top:0px} .OWWNBcpCurrentDateFilled {display: none;}
- globalWrapper{margin: 0 auto; padding: 0; width: 900px;}
.firstHeading {display:none; width:0px;}
- content {margin-left: 0; padding: 0; border: none;}
- sidebar-main {display:none; width:0px;}
- footer{position: center; margin: 0;}
body {
margin: 0; font-family: Calibri, Verdana, helvetica, sans-serif; background: url(http://openwetware.org/images/2/21/Biomod-2012-ut-komaba-Metal-texture.jpg) darkgray repeat-y;
}
- content {
margin: 0;
}
/*title*/
- title{
margin: 10px 0; padding: auto; background-color: black; text-align :center;
}
- navi ul {
font-size: 12px; margin: 0 0 30px; padding: 0; text-align:center; height: 30px; background-color: black}
- navi ul li {
list-style-type: none; float: left; padding: 0; margin: 0; display: block}
- navi ul li a {
display: block; width: 100px; line-height: 30px; text-decoration: none; text-align: center; color: #ffffff; background-color: black;
}
- navi ul li a:hover {
background-color: gainsboro; color: black;
}
- bodyContent{
width: 800px; margin: auto; padding: 50px; background: url("http://openwetware.org/images/c/c2/Biomod_2012_UToyko_UT-Komaba_background.png") white repeat-y; font-size: 140%;
}
- toc{
font-size: 80%;
}
/* table */ table {
border: solid 1px black; border-collapse: collapse; border-spacing: 0;
}
table.noborder, table.noborder th, table.noborder td{
border: none;
}
table th{
border: solid 1px black; padding: 1px 5px; color: white; background-color: darkgray; text-align: center;
}
table td{
border: solid 1px black; padding: 1px 5px; text-align: center;
}
table.tdleft td{
text-align: left;
}
h1,h2,h3,h4 {
font-family: serif; clear: both;
}
table.dialog{
border: none;
}
table.dialog th{
border: none; padding-top: 0px; background-color: white; color: black; text-decolation: bold; text-align: left;
}
table.dialog td{
border: none; padding: 5px 0; text-align: left;
}
--> </style>
<div id="title"><img src="http://openwetware.org/images/4/47/Biomod_2012_UTokyo_UT-Komaba_Top.png" alt="DNA tablet" width="800" height="120" onClick="this.src='http://openwetware.org/images/7/7d/BIOMOD_2012_UTokyo_UT-Komaba_title-animation.gif'"/></div>
<div id="navi"> <ul>
<li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba">Home</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Idea">Idea</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Simulation">Simulation</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Experiment">Experiment</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Progress">Progress</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Episode">Episode</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Team">Team</a></li> <li><a href="/wiki/Biomod/2012/UTokyo/UT-Komaba/Supplementary">Supplementary</a></li>
</ul> </div>
</html>
Concept
The last but the most important experiment is the experiment of the DNA tablet. We combine modified origami and bistable system so that we can realize the DNA tablet. The purpose of the experiment is to observe the surface of the tablet and make sure that the surface change when we put another kind of DNA.
Method
Pseudo-hammerhead Structure
To make hammerhead structure, we needed to add some DNA sequences to existing staples witch didn't interact with other parts of DNA origami. We made such sequences from the sequence below.
GGAACCTCAGCCCAACTAACAT |
This sequence is known not to interact with other parts of DNA origami. We made three hammerhead structures from this.
(5' -> 3' direction)
addition to staple | cover | |
---|---|---|
1 | CTCCAAGGTTT - TTTAGCCCAAC | GAGGTTCCTCGGGTTG |
2 | CGACTCCATTT - TTTCCAACTAA | TGGGCTGATGATTGTA |
3 | ACCCGACTTTT - TTTACTAACAT | GCTGAGGTGGTTGATT |
The Design of the DNA Tablet
Using the three hammerhead structures, we designed the DNA origami.
Experiment
October 20th
We got the modified staples, so we made the staple mix for the main body of DNA tablet and tried observing it. In this experiment, we did not put cover DNA for hammerhead structures so that we might not observe pictures on the surface. However, DNA origami wasn't observed clearly.
October 22nd
We made modified origami in September 20th, but the origami was not structured. Therefore, we carefully made the modified staple mix again.
October 23rd
We made the modified origami again and prepare for the observation in October 24th.
October 24th
We observed the DNA tablet by AFM at the Komaba Campus. However, we could not get good pictures of the tablets from any tubes. From the pictures, the tablet seemed to not be well structured and partly collapsed.
October 25th
We prepard new staple mix of DNA tablet and made the tablet from staple mix we served in October 20th and the tablet from staple mix we served in October 25th. Because the modified origami succeeded when we put them in room temperature, we decided to keep the both tablets at the room temperature, about 20°C. Of course, there is possibility that we made some mistakes while making staple mix in October 20th so that the tablet did not structured, we kept one tube of the tablet made from staple mix in October 25th at 4°C. The purpose of the experiment is to observe the completely structured DNA tablet. We annealed them from 90°C to 20°C for 2800 seconds.
October 26th
We observed the DNA tablet which was made from staple mix served in October 25th and kept in the room temperature. We could clearly observe the main body of the DNA tablet.
After observing the main body of the tablet, we put cover DNA so that the body shows two pictures, though it depends on which cover DNA we put.
We could observe the sentence "I♡DNA" and the character, Tablet Boy on the surface of the tablet. Therefore, we could make sure that the tablet shows two pictures, and which picture it show depends on what cover DNA we put on its surface.