Pig-tailing to reduce stutter
From OpenWetWare
Return to Texas Switchgrass Collaborative
Pig-tailing is a technique of adding a few extra nucleotides to the 5' end of a reverse primer in order to prevent stuttering of microsatellite and other length polymorphism markers.
There are two options for Pig tailing that I know of, but I am not sure why to use one over the other:
PigA: GTTTCTT
PigB: GTTT
Make sure to attach them onto the 5' end of whichever primer you are "tailing." Make sure this is not the primer with a fluorescent or M13 label on it.
Here is an example of a reverse primer with PigA attached to it:
GTTTCTTGATCGCGCTCCTCTAATGTC