Primer Tm estimation methods
From OpenWetWare
| example primer | Marmur rule | Wallace rule | Breslauer '86 | SantaLucia '98 |
|---|---|---|---|---|
| ActB F: TTGCTGACAGGATGCAGAAG | 60 | 52 | 60.1 | 52.4 |
| ActB R: TGATCCACATCTGCTGGAAG | 60 | 52 | 59.8 | 51.5 |
| Tubb5 F: GATCGGTGCTAAGTTCTGGGA | 64 | 54 | 61.5 | 53.7 |
| Tubb5 R: AGGGACATACTTGCCACCTGT | 64 | 54 | 60.8 | 55.1 |
- Marmur formula: Tm = 4 x GC + 2 x AT
- not recommended for more than 13nt; assumes 50mM monovalent cations
- Marmur J and Doty P (1962) J Mol Biol 5:109-118; PMID 14470099
- Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
- Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748
- Breslauer et al. 1986, DOI:10.1073/ pnas.83.11.3746
- Primer3 and Primer3Plus default maintained for backwards compatibility
- SantaLucia 1998, DOI:10.1073/pnas.95.4.1460
- Primer3 recommended setting; also default settings of the NCBI's Primer BLAST