Biomod/2012/UTokyo/UT-Komaba/Experiment/Modified Origami: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 37: Line 37:




===How to design the modified origami===
===The design of the DNA tablet===
 
Using the three hammerhead structures, we designed the DNA origami.
 
[[Image:BIOMOD-2012-UTkyo-UTKomaba-design.png]]


==Experiment==
==Experiment==

Revision as of 16:07, 25 October 2012

<html>

<style type="text/css"> </style>

</html>

Concept

Modified Origami Concept
Modified Origami Concept

We combine DNA origami and pseudo-hammerhead structure so that, when cover DNAs hybridize to the structure, the hammerhead forms and the surface of the modified origami shows a picture. Therefore, if we can set up the bistable system so that it produces the cover DNAs for different images, we can realize the DNA tablet. The purpose of the experiment is to make sure that the additional single strand necessary for the hammerhead structure DNAs do not disturb during annealing in PCR. We observe the modified DNA origami with cover DNA by AFM.


Method

Pseudo-hammerhead Structure

To make hammerhead structure, we needed to add some DNA sequences to existing staples witch didn't interact with other parts of DNA origami. We made such sequences from the sequence below.

Hammerhead structure
GGAACCTCAGCCCAACTAACAT

This sequence is known not to interact with other parts of DNA origami. We made three hammerhead structures from this.

(5' -> 3' direction)

addition to staple cover
1 CTCCAAGGTTT - TTTAGCCCAAC GAGGTTCCTCGGGTTG
2 CGACTCCATTT - TTTCCAACTAA TGGGCTGATGATTGTA
3 ACCCGACTTTT - TTTACTAACAT GCTGAGGTGGTTGATT


The design of the DNA tablet

Using the three hammerhead structures, we designed the DNA origami.

Experiment

October 3rd

The Design of the Modified Origami
The Design of the Modified Origami

We designed the modified origami and annealed them for about an hour in PCR. On the surface of one origami, there are 15 hammerhead structure and 1 hairpin structure. Therefore, we order DNA which composes the structures and replace staple strands of normal origami with them. We drew three lines on the surface by the hammerhead structures, and one line consisted of 5 hammerhead structures. The abstract design of the origami is the picture above.

More Information


October 5th

Modified Origami


We made modified origami in October 3rd and keep them at the laboratory room temperture. We observed the modified origami by AFM and we get the clear picture of lines on the surface of the origami. The three lines on the surface shows the fact that the modified origami which have hammerhead structures was well-done. Also, the picture below proved that we can observe a hammerhead structure as a dot so that we can draw a picture on the origami surface.


October 25th

The purpose of the experiment is to find out the reason why we could not observe the tablet by AFM in October 24th. To make sure whether we could not observe it because of AFM or not, we made modified origami which we succeeded in October 3rd. We made the modified origami in the same condition as that in October 3rd.

More Information