IGEM:Harvard/2007/Laboratory Notebooks/Two Component System: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
EllenorB (talk | contribs)
No edit summary
EllenorB (talk | contribs)
No edit summary
Line 218: Line 218:
-In the assay we also compared AA93 and "regular" BL21 cells.  None of the BL21 samples fluoresced.  We assume the BL21 cells have there normal Fec system, but given the GFP plasmid, there was no fluorescence.<br>
-In the assay we also compared AA93 and "regular" BL21 cells.  None of the BL21 samples fluoresced.  We assume the BL21 cells have there normal Fec system, but given the GFP plasmid, there was no fluorescence.<br>
-We have digested and ligated FecA (Nde1 and BglII) and FecIR (NcoI and BamHI) into pCola (separately).  The pCola-A colonies as few, but present.  pCOla-IR colonies are numerous.  We'll have to run some gels to see if our constructs are correct.<br>
-We have digested and ligated FecA (Nde1 and BglII) and FecIR (NcoI and BamHI) into pCola (separately).  The pCola-A colonies as few, but present.  pCOla-IR colonies are numerous.  We'll have to run some gels to see if our constructs are correct.<br>
'''8/9/07'''<br>
-Yesterday, we ran a lysogenization test using T7 Tester Phage.  If our cells are DE3, then they can support T7 Phages. Results today show that our cells are DE3's and grew larger viral plaques when induced by IPTG.<br>

Revision as of 15:03, 9 August 2007

6/27/07
- Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.

The oligos ordered were as follows:

Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’

Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’


6/27/07
- Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x. [edit]


6/28/07
- Miniprepped to prepare for sequencing, nanodropped to confirm presence of DNA, sequencing rxns:

SV001 - FecA plus VF2

SV002 - FecA plus VR

SV003 - FecR plus VF2

SV004 - FecR plus VR

SV005 - FecI plus VF2

SV006 - FecI plus VR


PCR extension of constructs 1 and 2
-3 cycles of PCR
-diluted first to 500 uM, then to 20 uM
-15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each.
-two redundant reactions, R1 and R2
-R2 may be wrong becuase of volume errors


6/28/07
Miniprep done. Sent for sequencing.

Emails sent to:

Duke:
Dr. Homme W. Hellinga
Dr. Loren L. Looger

Penn State:
Dr. Hossein Fazelinia
Dr. Costas D. Maranas
Dr. Gregory L. Moore


PCR extension of constructs 1 and 2
-3 cycles of PCR
-diluted first to 500 uM, then to 20 uM
-15 uL of water, 10 uL of DNA, 25 uL of PCR master mix for each.
-two redundant reactions, R1 and R2
-R2 may be wrong becuase of volume errors


6/29/07
Reply from George Khoury of Penn State lab under Maranas. He has agreed to assist us with computational design.


Week of 7/1/07
Continued contact with George Khoury, including a cell phone conversation w/ Ellenor on 7/3/07 and an in-person talk w/ Shaunak to be scheduled for 7/7/07. We've decided on lead (Pb) a small molecule ligand and Muc1 as a macromolecule (glycoprotein) ligand for FecA. Muc1 is a cancer antigen, a glycoprotein overexpressed on tumor cells. They are underglycolysated on cancerous cells.


7/5/07
Directed Mutagenesis of FecA and FecR to remove Pst1 restriction site.


7/6/07
Transformation of FecA' and FecR' (pending recovery of previous day's PCR product)
Also, Shaunak and George's meeting went well. Notes are under "Brainstorming"


Weekend of 7/7/07
7/7/07: Transformation of FecA' and FecR' into cells, completing the Quickchange Kit protocol.
7/8/07: Growth of liquid cultures from mutagenesis.
7/9/07 - miniprep of site directed mutagenesis using QiaGen Miniprep kit
- Plates streaked with cells containing FecA' and FecR' from liquid cultures.
- Digestion with Pst1 performed on a portion of miniprepped plasmids and on plasmids containing FecA and FecR.
- Egel was run to determine whether the mutagenesis was successful. FecA' (A1B) and FecR' (R5B) were placed into liquid culture from previously streaked plate. FecI was grown in liquid culture. The mutagenesis looks successful.
- purification of construct C1+C2 extension rxn R1 using QiaGen PCR purification protocol--labeled product 'FecA promoter biobrick'
- received E Coli AA93, plasmid pLCIRA, pGFPA' from Germany, waiting on instructions from Dr. Braun on how to plate them.
- grow E0240 in liquid culture


7/13/07
-Have grown up German constructs in LB, will be doing plasmid minipreps on pGFPA', pLCIRA in order to electroporate into AA93.
-plasmid minipreps done, pGFPA' is 205.2 ng/ul, pLCIRA is 53.2 ng/ul
-electroporation (see general protocol)--used 1 mL of AA93 cells, 25 ng of each plasmid (pGFPA' and pLCIRA): 2 samples, T1 (time constant 5.2) and T2 (time constant 5.0)


7/17/07 - 7/18/07 Fec signal induction
Day 1:
-Prepare WL nutrient broth for use in liquid culture. Grow overnight; should be a color change from deep blue toward green or yellow.
-Make 1mM and 4mM solutions of sodium citrate and ferric citrate.
-Make a 50uM solution for dipyridyl.
-In 96-well plate, use relevant combinations of 200 uL of cells, 50 uL of sodium- or ferric-citrate, and 50 uL of dipyridyl.

Results: NO FLUORESCENCE


Day 2:
-Take 200uL samples of T1 in WL (8 used).
-Spin down half of these samples and resuspend in 200uL of LB.
-Add Carb and Chloro... to challenge. Add relevant combinations of 50uL of 4mM sodium- or ferric- citrate.
-Grow all in small liquid culture tubes for an hour.
-Add 100uL of 50mM dipyridyl to appropriate liquid cultures. Let continue growing for 40 minutes. -Transfer to 1.5 mL centerfuge tubes. Spin for 1 min at 13000rpm. Resuspend in 300uL PBS. Repeat until WL color is not visible in resuspension.
-Add 200uL of resuspensions to 96-well plate. Check for fluorescence using plate reader, fluorometric microscope etc.

Results: NO FLUORESCENCE


7/19/07
-Restarting from transformation phase. Electroporation of regrown AA93 and pGFPA in AA93. Double transformation of pGFPA and pLCIRA into AA93, 25 ng each. Transformation of 50ng pLCIRA into pGFPA-containing cells. plate 250uL.
-Parallel chemical transformations, using 1uL of pGFPA for one transformation and 1uL of each of the plasmids for double transformation into NovaBlue Cells (already have have Fec system in place).
-Ordered sequencing primers for our Fec promoter-GFP construct. plate 50uL of cells, also 5uL cells with 45uL LB.
-In place of GPF construct E0240, which has been shown not to work, we have changed to I13507, for RFP. This will not create a problem since the constructs 1 and 2 that we designed are simply the Fec promoter. We will do a ligation to ligate the fec promoter to I13507.


7/20/07
-Results of yesterday's transformations suggest that chemical transformation is more effective than electroporation, at least for the protocols we have used. Results also show that single tranformation of pCLIRA is much more effective than cotransformation of pCLIRA and pGFP.
-Digestion of I13507 using EcoR1 and Xba and EcoR1 and Spe for Fec (F).
-PCR purification of I13507 and nucleotide removal for Fec.
-Ligation of digestion products and transformation into chemically competent cells.
-Liquid culture of transformed plasmid.
-PIZZA!!


weekend, 7/21/07
-Tested induction with 8mM citrate: no fluorescence.
-retransformed Fec responsive RFP construct.


7/23/07
-Made the pGFPA' sequencing primer and sent for sequencing.
-Did assays using dipyridyl, then a delay, then sodium or ferric citrate. Used 8mM of citrates, added 4uL of dip to 150uL of citrates and 1mL of cells. NO FLUORESCENCE!
-Replenished cell stocks for assay.
-Colony PCR to determine if our RFP constructs are correct and working.
-Put constitutive GFP into broth for later use, trying to see how GFP expression looks in broth.


7/24/07
-Looked at constitution GFP in LB and WL and certain promising assay samples under fluorometric microscope. Again, no fluorescence from our assays. The constitutive GFP worked as expected. GFP: 485 excitation, 538 emission.
-Shaunak received an email back from Ferguson who co-authored a paper working with Fec induction.

Key points:

1) Do 1:100 - 1:1000 dilution because 1:1 puts cells almost in log phase.
2) Citrate induction takes about 8 hours. Monitor for 8-12 hours at 37C.
3) WL broth should not cause visualization problems.
4) Do not add dipyridyl.
5) Inducing in LB won't work.
6) German constructs are probably not the issue.

YAY! The current overnight assay in the plate reader is AA93 and co-transformed AA93 with 1:100, 1:500, and 1:1000 cell dilution. We used 3uL of 10mM sodium citrate with 300uL of broth. We also used 3uL, 0.6uL and 0.3uL of cells for the respective dilutions. Results in 15 hours!!! (or more since we aren't coming in at 5:30am tomorrow).


7/25/07
-Further "YAY!"ing has been postponed due to a failure to induce GFP expression. In other words: NO FLUORESCENCE!!
-Upon checking the results of the plate reader by using the microscope, it was confirmed that there were NO CELLS in the samples. Which makes sense given that the wells were not cloudy. We have grown our cotransformed AA93 cells in 1:1 dilution with both WL and LB, neither of which grows appreciably faster. Having our cell density ready for another overnight run is highly unlikely.
-In addition, we are doing a colony PCR to see if our AA93s are in fact CO-transformed. We boiled the cells for 5 minutes in water before putting it in the pcr machine.
-Addendum: We did not do a kinetic run last night. We have seen no growth. Thus we assume our cells are dead. 6 new cultures have been made:

1) AA93 cotrans in WL
2) AA93 cotrans in LB
3) AA93 cotrans in WL, no challenge (Jagesh suggested that antibiotics might be a problem)
4) AA93 cotrans in LB, no challenge
5) NovaBlue pGFPA' in WL
6) NovaBlue pGFPA' in LB


7/26/07
-As of this morning the cells seem to be growing for the most part. Both types of cells grow well in LB, as expected. There is no clear difference in confluence among the LB samples. However, it seems that NovaBlue cells don't grow well, if at all, in WL broth. The unchallenged AA93 cells did the best (based on color, which was the lightest green of the three), followed by the challenged AA93 cells.
-We are preparing primers for a two step pcr and ligation.

7/27/07
-August is fast approaching and fluorescence still eludes us. That's right folks... NO FLUORESCENCE!!
- Our overnight run consisted of the 6 new cultures used in the 3 dilutions of the previous assays. Our control was AA93 cotransformed in WL, un-challenged. The plate reader results and the microscope check showed no fluorescence, though our cells were not dead.
-Next steps include LB and ferric citrate, redoing our assays in liquid culture tubes, using our RFP construct, another colony pcr (with different protocol and the use of a ladder), and whatever else pops into our heads to make this thing work.


7/30/07
-We ran an assay Friday night using LB vs WL, the previous cell dilutions, and NaCit vs FeCit in 1mM, 5mM, 10mM, 50mM, and 100mM solutions. Results: FLUORESCENCE!!!!!
By performance:
1) 10mM NaCit, LB, 1:100
2) 10mM Nacit, LB, 1:500
2) 10mM NaCit, LB, 1:1000
4) 5mM NaCit, LB, 1:1000
5) 50mM NaCit, LB, 1:1000

No other samples fluoresced. So, WL and ferric citrate are not inducing the cells, which is troubling/annoying. But out fluorescence readings exceed 700RFU for each of the fluorescences, and all else have a less than 200RFU. Our results were checked using the microscope.

-Next steps: How to insert a library. We are using TOPO cloning and, possibly, the 2 step pcr digestion-ligation.

-We've run Egels to see how long our plasmids are by cutting with EcoR1 and letting the gel tell us the length of the pieces, we should be getting two bands since we used a miniprep of co-transformed cells. Results pending

8/1/07
-For the past 2 days we've been trying to grow up cultures for an assay based primarily on the suggestions we've been given by Jagesh. We want to test combinations of our plasmids in AA93 and BL21 cells. For some reason, the cotransformation for the BL21 cells isn't working, though we've transformed each separate plasmid. We've decided to go ahead with the assay without it since two attempts have failed. Oh the monotony...
-The assay will also test +/- NaCit at 10mM. The cell dilution will be 1:100, since concentration seems not to matter that much.


8/7/07
-We've PCR'ed FecA and FecIR to be put into pCola duet vectors in hopes that we will avoid the Fur repressor and work with a familiar plasmid for which we can get a sequence. The pcr's worked well based on results from a diagnostic Egel.
-We grew up and minipreped pCola. It is, however, a very look copy plasmid, so a miniprep of 2ml gave us only 7ng/uL. We will retry using 10mL.
-We are preparing for lysogenization of AA93 cells because our pCola plasmid needs a T7 system. Comercial DE3 plasmids, or the one that we found, had the same origin as our GFP plasmid so we could not use it.
-Our last plate reader assay showed two more times that NaCit in LB works. FeCit and Dipyridyl still do not seem to work. neither does dipyridyl with NaCit. Dipyridyl would be a nice iron chelator for testing of our mutagenenized Fec system in case the fur repressor creates a problem. Citrate is an iron chelator, but we would not be able to tell if Citrate or the new target ligand were creating the signal. And all media we use will need iron because cells need it to survive.
-In the assay we also compared AA93 and "regular" BL21 cells. None of the BL21 samples fluoresced. We assume the BL21 cells have there normal Fec system, but given the GFP plasmid, there was no fluorescence.
-We have digested and ligated FecA (Nde1 and BglII) and FecIR (NcoI and BamHI) into pCola (separately). The pCola-A colonies as few, but present. pCOla-IR colonies are numerous. We'll have to run some gels to see if our constructs are correct.


8/9/07
-Yesterday, we ran a lysogenization test using T7 Tester Phage. If our cells are DE3, then they can support T7 Phages. Results today show that our cells are DE3's and grew larger viral plaques when induced by IPTG.