IGEM:MIT/2006/Notebook/2006-8-9: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Boyuanzhu (talk | contribs)
Veenav (talk | contribs)
 
(3 intermediate revisions by 2 users not shown)
Line 4: Line 4:
==Our New Biobricks!==  
==Our New Biobricks!==  
Let's give a big warm welcome to:  
Let's give a big warm welcome to:  
#J45100 (Prom40+RBS30+BSMT+Term15)
#J45100 (Prom40+RBS30+BSMT+Term15) [A/T]
#J45120 (Prom40+RBS32+BSMT+Term15)  
#J45120 (Prom40+RBS32+BSMT+Term15) [A/T]
#J45170 (PromOS+RBS32+BSMT+Term15)
#J45170 (PromOS+RBS32+BSMT+Term15) [A/T]
#J45200 (Prom40+RBS30+ATF1+Term15)
#J45200 (Prom40+RBS30+ATF1+Term15) [A/T]
#J45220 (Prom40+RBS32+ATF1+Term15)
#J45220 (Prom40+RBS32+ATF1+Term15) [A/T]


We will also be updating the registry with all of our intermediate parts as well. Here's a quick outline of our planned number scheme:  
We will also be updating the registry with all of our intermediate parts as well. Here's a quick outline of our planned number scheme:  


#J45098 (BSMT+Term15) [A/K]
#J45099 (RBS30+BSMT+Term15) [A/T]
#J45119 (RBS32+BSMT+Term15) [A/T]
#J45199 (RBS30+ATF1+Term15) [A or A/K]
#J45219 (RBS32+ATF1+Term15) [A or A/K]


#J45098 (BSMT+Term15)
And, there are always our coding regions...
#J45099 (RBS30+BSMT+Term15)
#J45001 (SAMT) [A]
#J45119 (RBS32+BSMT+Term15)
#J45002 (BAMT) [A]
#J45198 (RBS30+ATF1)
#J45004 (BSMT) [A]
#J45199 (RBS30+ATF1+Term15)
#J45008 (BAT2 with SpeI site) [A/T]
#J45218 (RBS32+ATF1)
#J45014 (ATF1 with mutation to eliminate EcoRI, but still has a random mutation) [A]
#J45219 (RBS32+ATF1+Term15)


J453xx, 4xx etc will be for the next devices we build.
J453xx, 4xx etc will be for the next devices we build.
Line 27: Line 31:
#*remember ATF1 parts prob have 2 RBS
#*remember ATF1 parts prob have 2 RBS
#SMELL LCs (and miniprep plus sequence promising ones)
#SMELL LCs (and miniprep plus sequence promising ones)
#*remember that the ATF1 assembly is a mutant version
#*remember that the ATF1 assembly is a mutant version [J45014]
#ATF1 mutagenesis (??)
#ATF1 mutagenesis (??)
#make LCs of pUCP22 cell colonies (LB Amp)
#make LCs of pUCP22 cell colonies (LB Amp)
#make LCs of overnight transformants (all in LB A/T, some with SA or IA)
#make LCs of overnight transformants (all in LB A/T, some with SA or IA)
==BAT2 mutation primers to eliminate SpeI==
Primer pair 3
                                *
    Forward: 5' CGGGCAAGAAGGAACTGGTTACTGCTCCACTAG 3'
    Reverse: 5' CTAGTGGAGCAGTAACCAGTTCCTTCTTGCCCG 3'
                                *
    GC content: 54.55%          Location: 32-64
    Melting temp: 80.6°C        Mismatched bases: 1
    Length: 33 bp                Mutation: Substitution
    5' flanking region: 16 bp    Forward primer MW: 10187.73 Da
    3' flanking region: 16 bp    Reverse primer MW: 10080.66 Da

Latest revision as of 22:51, 9 August 2006

Smells!!!! : )

  • the banana and wintergreen generating devices are assembled and WORKING!!! YAY!!! what an exciting day :-D

Our New Biobricks!

Let's give a big warm welcome to:

  1. J45100 (Prom40+RBS30+BSMT+Term15) [A/T]
  2. J45120 (Prom40+RBS32+BSMT+Term15) [A/T]
  3. J45170 (PromOS+RBS32+BSMT+Term15) [A/T]
  4. J45200 (Prom40+RBS30+ATF1+Term15) [A/T]
  5. J45220 (Prom40+RBS32+ATF1+Term15) [A/T]

We will also be updating the registry with all of our intermediate parts as well. Here's a quick outline of our planned number scheme:

  1. J45098 (BSMT+Term15) [A/K]
  2. J45099 (RBS30+BSMT+Term15) [A/T]
  3. J45119 (RBS32+BSMT+Term15) [A/T]
  4. J45199 (RBS30+ATF1+Term15) [A or A/K]
  5. J45219 (RBS32+ATF1+Term15) [A or A/K]

And, there are always our coding regions...

  1. J45001 (SAMT) [A]
  2. J45002 (BAMT) [A]
  3. J45004 (BSMT) [A]
  4. J45008 (BAT2 with SpeI site) [A/T]
  5. J45014 (ATF1 with mutation to eliminate EcoRI, but still has a random mutation) [A]

J453xx, 4xx etc will be for the next devices we build.

To do

  1. check 42 sample sequencing order in VectorNTI
    • remember ATF1 parts prob have 2 RBS
  2. SMELL LCs (and miniprep plus sequence promising ones)
    • remember that the ATF1 assembly is a mutant version [J45014]
  3. ATF1 mutagenesis (??)
  4. make LCs of pUCP22 cell colonies (LB Amp)
  5. make LCs of overnight transformants (all in LB A/T, some with SA or IA)

BAT2 mutation primers to eliminate SpeI

Primer pair 3

                               *
   Forward: 5' CGGGCAAGAAGGAACTGGTTACTGCTCCACTAG 3'
   Reverse: 5' CTAGTGGAGCAGTAACCAGTTCCTTCTTGCCCG 3'
                               *
    GC content: 54.55%           Location: 32-64
    Melting temp: 80.6°C         Mismatched bases: 1
    Length: 33 bp                Mutation: Substitution
    5' flanking region: 16 bp    Forward primer MW: 10187.73 Da
    3' flanking region: 16 bp    Reverse primer MW: 10080.66 Da