840:153g:Projects/project10/2010/09/30

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

[[Image:9 30 10Group10.jpg]]==Entry title==

  • This week we finished DNA extraction from P. chrysosporium and ran a gel electrophoresis to determine presence of DNA... it worked! We know it worked because we see DNA on the gel. We also figured out our primers - forward with biobrick extension "Sneezy" GTTTCTTCGAATTCGCGGCCGCTTCTAGCCTTCGTATGTAAGTCGCTG, reverse with biobrick extension "Cowgirl" TACTAGTAGCGGCCGCTGCAGGAAGAAACCGCCGTGCGCGAGTCGCGCG, forward without biobrick extension "Grumpy" CCTTCGTATGTAAGTCGCTG, and reverse without biobrick extension "Cowboy" CGCCGTGCGCGAGTCGCGCG - to be ordered.

Next time we will hopefully receive our primers and run PCR to determine if the primers work.