User:Mingjie Li/Notebook/Light switch/2008/11/13

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

ML1-1

  • Optimize gene:
    • 1. Arabidopsis PHYB(NT): Length:1866;

Sequence: ATGGTGAGCGGAGTGGGAGGCAGCGGAGGAGGAAGGGGCGGCGGAAGGGG AGGAGAGGAGGAGCCTAGCAGCAGCCACACCCCTAACAACAGGAGGGGAGGAGAGCAGGC TCAGAGCAGCGGAACCAAGAGCCTGAGGCCTAGGAGCAACACCGAGAGCATGAGCAAGGC CATCCAGCAGTACACCGTGGACGCCAGGCTGCACGCCGTGTTCGAGCAGAGCGGCGAGAG CGGCAAGAGCTTCGACTACAGCCAGAGCCTGAAGACCACCACCTACGGCAGCAGCGTGCC TGAGCAGCAGATCACAGCCTACCTGAGCAGAATCCAGAGGGGCGGCTACATCCAGCCTTT CGGCTGCATGATCGCCGTGGACGAGAGCAGCTTCAGGATCATCGGCTACAGCGAGAACGC CAGGGAGATGCTGGGCATCATGCCTCAGAGCGTGCCTACCCTGGAGAAGCCTGAGATCCT GGCCATGGGCACCGACGTGAGGAGCCTGTTCACCAGCAGCAGCAGCATCCTGCTGGAGAG GGCCTTCGTGGCCAGGGAGATCACACTGCTCAACCCTGTGTGGATTCACAGCAAGAACAC CGGCAAGCCTTTCTACGCCATCCTGCACAGGATCGACGTGGGCGTGGTCATCGACCTGGA GCCTGCTAGGACCGAGGACCCTGCCCTGAGCATCGCTGGAGCTGTGCAGAGCCAGAAGCT GGCCGTGAGGGCTATCAGCCAGCTGCAGGCCCTGCCTGGCGGCGACATCAAGCTGCTGTG CGACACCGTGGTGGAGAGCGTGAGGGACCTGACCGGCTACGACAGAGTGATGGTGTACAA GTTCCACGAGGACGAGCACGGCGAGGTGGTGGCCGAGAGCAAGAGGGACGACCTGGAGCC TTACATCGGCCTGCACTACCCTGCCACCGACATCCCTCAGGCCAGCAGGTTCCTGTTCAA GCAGAACAGGGTGAGGATGATCGTGGACTGCAACGCCACCCCTGTGCTCGTGGTGCAGGA CGACAGGCTGACCCAGAGCATGTGCCTGGTGGGCAGCACCCTGAGGGCCCCTCACGGCTG CCACAGCCAGTACATGGCCAACATGGGCAGCATCGCCAGCCTGGCCATGGCCGTGATCAT CAACGGCAACGAGGACGACGGCAGCAACGTGGCCAGCGGCAGGAGCAGCATGAGGCTGTG GGGCCTGGTGGTGTGCCACCACACCAGCAGCAGGTGCATCCCTTTCCCTCTGAGATACGC CTGCGAGTTCCTGATGCAGGCCTTCGGCCTGCAGCTGAACATGGAGCTGCAGCTGGCCCT GCAGATGAGCGAGAAGAGGGTGCTGAGGACCCAGACCCTGCTGTGCGACATGCTGCTGAG GGACAGCCCTGCCGGCATCGTGACCCAGAGCCCTAGCATCATGGACCTGGTGAAGTGCGA CGGCGCCGCCTTCCTGTACCACGGCAAGTACTACCCTCTGGGCGTGGCCCCTAGCGAGGT GCAGATCAAGGACGTGGTGGAGTGGCTGCTGGCCAACCACGCCGACAGCACCGGCCTGAG CACCGACAGCCTGGGCGACGCTGGATACCCTGGAGCTGCCGCCCTGGGCGACGCCGTGTG CGGCATGGCCGTGGCCTACATCACAAAGAGGGACTTCCTGTTCTGGTTCAGGAGCCACAC CGCCAAGGAGATCAAGTGGGGCGGCGCCAAGCACCACCCTGAGGACAAGGACGACGGCCA GAGGATGCACCCTAGGAGCAGCTTCCAGGCCTTCCTGGAGGTGGTGAAGAGCAGGAGCCA GCCTTGGGAGACCGCCGAGATGGACGCCATCCACAGCCTGCAGCTGATCCTGAGGGACAG CTTCAAGGAGAGCTGA

    • 2:Arabidopsis PIF3: Length:1575;

Sequence: ATGCCTCTGTTCGAGCTGTTCAGGCTGACCAAGGCCAAGCTGGAGAGCGC CCAGGACAGGAACCCTAGCCCTCCTGTGGACGAGGTGGTGGAGCTGGTGTGGGAGAACGG CCAGATCAGCACCCAGAGCCAGAGCAGCAGGAGCAGGAACATCCCTCCTCCTCAGGCCAA CAGCAGCAGGGCCAGGGAGATCGGCAACGGCAGCAAGACCACCATGGTGGACGAGATCCC TATGAGCGTGCCTAGCCTGATGACCGGCCTGAGCCAGGACGACGACTTCGTGCCTTGGCT GAACCACCACCCTAGCCTGGACGGCTACTGCAGCGACTTCCTGAGGGACGTGAGCAGCCC TGTGACCGTGAACGAGCAGGAGAGCGACATGGCCGTGAACCAGACCGCCTTCCCTCTGTT CCAGAGGAGGAAGGACGGCAACGAGAGCGCCCCTGCCGCCAGCAGCAGCCAGTACAACGG CTTCCAGAGCCACAGCCTGTACGGCAGCGACAGGGCCAGGGACCTGCCTAGCCAGCAGAC CAACCCTGACAGGTTCACCCAGACCCAGGAGCCTCTGATCACAAGCAACAAGCCTAGCCT GGTGAACTTCAGCCACTTCCTGAGGCCTGCCACCTTCGCCAAGACCACCAACAACAACCT GCACGACACCAAGGAGAAGAGCCCTCAGAGCCCTCCTAACGTGTTCCAGACCAGGGTGCT GGGCGCCAAGGACAGCGAGGACAAGGTGCTGAACGAGAGCGTGGCCAGCGCCACCCCTAA GGACAACCAGAAGGCCTGCCTGATCAGCGAGGACAGCTGCAGGAAGGACCAGGAGAGCGA GAAGGCTGTGGTGTGCAGCAGCGTGGGCAGCGGCAACAGCCTGGACGGACCTAGCGAGAG CCCTAGCCTGAGCCTGAAGAGGAAGCACAGCAACATCCAGGACATCGACTGCCACAGCGA GGACGTGGAGGAGGAGAGCGGCGACGGAAGGAAGGAGGCTGGACCTAGCAGGACCGGCCT GGGCAGCAAGAGGAGCAGGAGCGCCGAGGTGCACAACCTGTCTGAGAGGAGGAGGAGGGA CAGGATCAACGAGAAGATGAGGGCTCTGCAGGAGCTGATCCCTAACTGCAACAAGGTGGA CAAGGCCAGCATGCTGGACGAGGCCATCGAGTACCTGAAGAGCCTGCAGCTGCAGGTGCA GATCATGAGCATGGCCAGCGGCTACTACCTGCCTCCTGCCGTGATGTTCCCTCCTGGAAT GGGACACTACCCTGCTGCTGCTGCTGCTATGGCTATGGGAATGGGAATGCCTTACGCTAT GGGCCTGCCTGACCTGAGCAGGGGAGGCAGCAGCGTGAACCACGGACCTCAGTTCCAGGT GAGCGGAATGCAGCAGCAGCCTGTGGCTATGGGCATCCCTAGGGTGAGCGGAGGAGGAAT CTTCGCTGGCAGCAGCACCATCGGAAACGGCAGCACCAGGGACCTGAGCGGCAGCAAGGA CCAGACCACCACCAACAACAACAGCAACCTGAAGCCTATCAAGAGGAAGCAGGGCAGCAG CGACCAGTTCTGCGGCAGCAGCTGA

    • 3: Ho1: Length:723;

Sequence: ATGAGCGTGAACCTGGCCAGCCAGCTGAGGGAGGGCACCAAGAAGAGCCA CAGCATGGCCGAGAACGTGGGCTTCGTGAAGTGCTTCCTGAAGGGCGTGGTGGAGAAGAA CAGCTACAGGAAGCTGGTGGGCAACCTGTACTTCGTGTACAGCGCCATGGAGGAGGAGAT GGCCAAGTTCAAGGACCACCCTATCCTGAGCCACATCTACTTCCCTGAGCTGAACAGGAA GCAGAGCCTGGAGCAGGACCTGCAGTTCTACTACGGCAGCAACTGGAGGCAGGAGGTGAA GATCAGCGCCGCTGGACAGGCCTACGTGGACAGGGTGAGGCAGGTGGCTGCTACCGCTCC TGAGCTGCTGGTGGCTCACAGCTACACCAGGTACCTGGGCGACCTGAGCGGAGGCCAGAT CCTGAAGAAGATCGCCCAGAACGCCATGAACCTGCACGACGGCGGCACCGCCTTCTACGA GTTCGCCGACATCGACGACGAGAAGGCCTTCAAGAACACCTACAGGCAGGCCATGAACGA CCTGCCTATCGACCAGGCCACCGCCGAGAGGATCGTGGACGAGGCCAACGACGCCTTCGC CATGAACATGAAGATGTTCAACGAGCTGGAGGGCAACCTGATCAAGGCCATCGGCATCAT GGTGTTCAACAGCCTGACCAGGAGGAGGAGCCAGGGCAGCACCGAAGTGGGCCTGGCCAC CAGCGAGGGCTGA

4.PcyA: Length:747; Sequence: ATGGCCGTGACCGACCTGAGCCTGACCAACAGCAGCCTGATGCCTACCCT GAACCCTATGATCCAGCAGCTGGCCCTGGCCATCGCCGCCAGCTGGCAGAGCCTGCCTCT GAAGCCATACCAGCTGCCTGAGGACCTGGGCTACGTGGAGGGCAGGCTGGAGGGCGAGAA GCTGGTCATCGAGAACAGGTGCTACCAGACCCCTCAGTTCAGGAAGATGCACCTGGAGCT GGCCAAAGTGGGCAAGGGCCTGGACATCCTGCACTGCGTGATGTTCCCTGAGCCTCTGTA CGGCCTGCCTCTGTTCGGATGCGACATCGTGGCTGGACCTGGAGGCGTGAGCGCCGCTAT CGCTGACCTGAGCCCTACCCAGAGCGACAGGCAGCTGCCTGCTGCCTACCAGAAGAGCCT GGCTGAGCTGGGACAGCCTGAGTTCGAGCAGCAGAGGGAGCTGCCTCCTTGGGGAGAGAT CTTCAGCGAGTACTGCCTGTTCATCAGGCCTAGCAACGTGACCGAGGAGGAGAGGTTCGT GCAGAGGGTGGTGGACTTCCTGCAGATCCACTGCCACCAGAGCATCGTGGCCGAGCCTCT GAGCGAGGCCCAGACCCTGGAGCACAGGCAGGGCCAGATCCACTACTGCCAGCAGCAGCA GAAGAACGACAAGACCAGGAGGGTGCTGGAGAAGGCCTTCGGCGAGGCCTGGGCCGAGAG GTACATGAGCCAGGTGCTGTTCGACGTGATCCAGTGA

  • Order plasmid: pCL-CTIG
  • Design primer for first sequencing:
    • pML1-1F:gtaacaactccgccccatt
Wrong´╝üThis sequence is repeated.
pML1-1F': ttgacgtcaatgggtggagt
    • pML1-1R:tccagctcgaccaggatg
  • Design primer for second sequncing:
    • pML1-1F': ttgacgtcaatgggtggagt
    • pML1-1R2: ACGTCCTCGCCGTCTAAGT


sequencing result

  • GGGACACACGCGCAGACTGTCGACGGCCCCCCCGACCGATGTCAGCCTGGGGGACGAGCTCCACTTAGACGGCGAGGACGTGGCGATGGCGCATGCCGACGCGCTAGACGATTTCGATCTGGACATGTTGGGGGACGGGGATTCCCCGGGTCCGGGATTTACCCCCCACGACTCCGCCCCNTACGGCGCTCTGGATATGGCCGACTTCGAGTTTGAGCAGATGTTTACCGATGCCCTTGGAATTGACGAGTACGGTGGGTAGGGGGCGCGAGGATCCCCCGGGCTGCAGGAATTCCTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGAATTCGATCGTTGGTTTAAACCAACAACCGGTACCTCT-AGCGCTACCGGTCGCCAC



Personal tools