Wednesday 2nd June 2010
Today we received luxAB and luxCDE from the Edinburg team, so I performed a hot start PCR with rtth to extract them, I made two of each because I use both the primers they sent and also our primers for prefix and suffix, the samples were labeled as follows:
- AB1: using Edinburg primers
- AB2: using our suffix and prefix primers
- CDE1: using Edinburg primers
- CDE2: using Edinburg primers
here’s the mail we received from Edinburg team:
I've sent the luxCDE
>>>>> template
>>>>> and also BioBrick K216016 which is a composite BioBrick containing
>>>>> luxAB, with the PyeaR promoter; you can use this to check activity.
>>>>> It
>>>>> is induced by nitrate.
>>>>>
>>>>> I've also included forward and reverse primers for luxAB and
>>>>> luxCDE.
>>>>> The primers are all at 50 pmol/ul. The sequences are:
>>>>>
>>>>> BBluxABf1: tctagagctc aaatagcaatataaggac
>>>>> BBluxABr1: ccctactagta ttattaggtatattccatgtgg
>>>>> BBluxCf1: atcgaattcgcggccgcttctagag taatttaaggagattgtatg
>>>>> BBluxEr1: atcacatagta cacttacaattaggcaaagg
>>>>>
>>>>> You'll be able to clone luxCDE as EcoRI/SpeI, but the luxAB primers
>>>>> are designed to clone it as a SacI/SpeI fragment (I have a set of
>>>>> construction vectors with a SacI site overlapping the XbaI site);
>>>>> the
>>>>> forward primer does have an XbaI site but it is right at the end of
>>>>> the primer so may not cut effectively. You might have to clone the
>>>>> PCR
>>>>> product in a TA vector first before cutting it out, or
>>>>> alternatively
>>>>> order a new forward primer with an EcoRI site.
>>>>>
>>>>> Now that I think about it, it would have been simpler to include
>>>>> one
>>>>> of my construction vectors with the SacI site. The main one I use
>>>>> is
>>>>> J33207, which has Plac+lacZ', so you can cut out the insert,
>>>>> replace
>>>>> it with a SacI/SpeI insert, and select white colonies on Xgal/IPTG
>>>>> plates. It was in the 2008 distribution, if you still have it, but
>>>>> apparently not any of the subsequent ones.
Then I extracted and transformed by heatshock the lambda cI inverter (BBa_Q04510) from kit plate 1 (2009), well: 18B.
After I put it to incubate overnight with a negative control in petri boxes with kanamycin.
|
iGEM Project name 1
Main project page
Previous entry Next entry
