User:Jarle Pahr/Meat

From OpenWetWare

Jump to: navigation, search

Sequences for species identification:

For papers on species identification of meat products, see:


Authentication of species in meat products by genetic techniques: http://link.springer.com/article/10.1007%2Fs00217-010-1417-1?LI=true#page-1

A set of degenerate primers was designed for amplification and sequencing of the cytochrome b (cyt b) gene of several species:

MEAT F:  CGAGGCCTMTAYTAYGG
MEAT R:  ATTGAKCGTAGGATTGCGTA


PCR reactions were carried out in 50 uL volume with 100-300 ng DNA template. PCR program: "3 min at 95C, then 35 cycles (30 s at 95C, 30 s at 50C, and 30 s at 72C) and a final extension step of 72C for 3 min." Genomic DNA was extracted from 30 mg muscle tissue, following the protocol of Roger and Bendich (Roger SO, Bendich AJ (1988) Extraction of DNA from plant tissues. Plant Mol Biol Manual A6:1–10). For highly processed products, 150 mg sample was used. Sequencing was carried out using the same primers as for PCR. DNA amplification with the primers MEAT F/R gave an amplicon of 555 bp in all tested species.


Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique: http://journals.tubitak.gov.tr/veterinary/issues/vet-07-31-3/vet-31-3-3-0601-30.pdf


Primers used by Ilhak and Arslan: PCR primers were designed based on Lahiff (2001).


PCR was performed in 50 uL reaction with Taq polymerase. An annealing temperature of 58 C was used for all primers. PCR program: 94 C 45 s, 58C 45 s and 72C 90 s. 30 cycles. Agarose gel electrophoresis was performed with a 1.5 % agarose gel, loaded with 15 uL PCR product and run at 100 V for 2 h.


Animal Direction Sequence Position in reference sequence Reference sequence accession
Bovine FWDGCCATATACTCTCCTTGGTGACA 8107/812J01394
BovineREV5’- GTAGGCTTGGGAATAGTACGA- 8377/8357
SheepFWD 5’- TTAAAGACTGAGAGCATGATA- 3’ 71/91 AF039171
SheepREV 5’- ATGAAAGAGGCAAATAGATTTTCG- 3’ 295/272
PorcineFWD 5’- GCCTAAATCTCCCCTCAATGGTA- 3’ 93/115 AF039170
PorcineREV5’- ATGAAAGAGGCAAATAGATTTTCG- 3’ 304/281
CatFWD 5’- CATGCCTATCGAAACCTAACATAA- 3’ 11101/11124 NC_001700
CatREV5’- AAAGAAGCTGCAGGAGAGTGAGT- 3’ 11373/11351
DogFWD 5’- GATGTGATCCGAGAAGGCACA- 3’ 8821/8841 NC_002008
DogREV5’- TTGTAATGAATAAGGCTTGAAG- 3’ 9142/9121


Detection of Adulteration and Identification of Cat’s, Dog’s, Donkey’s and Horse’s Meat Using Species-Specific PCR and PCR-RFLP Techniques: http://www.ajbasweb.com/ajbas/2009/1716-1719.pdf


Abdel-Rahman et al. developed PCR and PCR-RFLP methods for identification of cat's, dog's, donkey's and horse's meat. The primers used were as follows:


Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment
Cat’s SSR FWD CTCATTCATCGATCTACCCA
Cat’s SSR REV GTGAGTGTTAAAACTAGTACTAGAAGA
Dog’s SSR FWD GGAGTATGCTTGATTCTACAG
Dog’s SSR REV AGAAGTGGAATGAATGCC
Horse/Donkey SSR FWD TTCTGCTCTGGGTGTGCTACTT From Abdel-Rahman et al. 2009
Horse/Donkey SSR FWD CTACTTCAGCCAGATCAGGC From Abdel-Rahman et al. 2009
Donkey’s and Horse’s cytochrome-b FWD CCATCCAACATCTCAGCATGATGAAA
Donkey’s and Horse’s cytochrome-b REV GCCCCTCAGAATGATATTTGTCCTCA

SSR = Simple Sequence Repeat= RFLP = restriction fragment length polymorphism

Amplicon sizes from cat, dog and donkey were 672 and 808 bp respectively. The Horse/Donkey SSR primer and cytochrome-b primer pairs yielded amplicons of 221 and 359 bp, respectively. The annealing temperatures used for the four primer pairs were 52, 52, 55 and 58 C, respectively. PCR was carried out as follows: Initial denaturation: 94°C for 4 min. Amplification: 35 cycles, 94°C for 60s, annealing temperature at 52-58 for 60s, extensiona at 72°C for 60s. Final extension at 72°C for 10 min.


See also:

http://nxseq.bitesizebio.com/articles/neigh-need-for-ngs-for-meat-testing-in-the-mane-pcr-is-enough/

http://www.isag.us/index.asp?autotry=true&ULnotkn=true

Personal tools